ID: 1160782639

View in Genome Browser
Species Human (GRCh38)
Location 19:884600-884622
Sequence AGCCAGCGGGGACACCGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782639_1160782646 17 Left 1160782639 19:884600-884622 CCCTCACGGTGTCCCCGCTGGCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1160782646 19:884640-884662 AGCCTCGGCCTCGCACAGAATGG 0: 1
1: 0
2: 0
3: 13
4: 150
1160782639_1160782648 20 Left 1160782639 19:884600-884622 CCCTCACGGTGTCCCCGCTGGCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1160782648 19:884643-884665 CTCGGCCTCGCACAGAATGGTGG 0: 1
1: 0
2: 0
3: 2
4: 105
1160782639_1160782644 2 Left 1160782639 19:884600-884622 CCCTCACGGTGTCCCCGCTGGCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1160782644 19:884625-884647 GCAACGACACCTCTCAGCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782639 Original CRISPR AGCCAGCGGGGACACCGTGA GGG (reversed) Intronic
900128157 1:1077131-1077153 AGTCTACGGGGACTCCGTGAGGG + Intergenic
900371915 1:2336020-2336042 TGCAGGCGGGGACACCGTGGGGG - Intronic
900919483 1:5661587-5661609 GGCCAGGGAGGACTCCGTGAAGG - Intergenic
903340335 1:22650488-22650510 CCCCGGCGGGGACAGCGTGAAGG + Intergenic
904675670 1:32197932-32197954 AGCCCTCAGGGCCACCGTGATGG - Exonic
905379874 1:37554174-37554196 AGCCGGCGAAGACACCGGGACGG - Exonic
906698952 1:47843671-47843693 AACCAGCTGGAACACTGTGAAGG + Intronic
916023502 1:160814505-160814527 AGCCTGCCGGGACACAGAGAAGG + Exonic
916530189 1:165649250-165649272 AGACATGGGGGACACTGTGAGGG - Intronic
919791415 1:201293179-201293201 GGCCAGCAGGGACACCCTAAGGG - Intronic
920859530 1:209694092-209694114 AGCCACCAGGGACAGAGTGAAGG - Intronic
922697721 1:227739903-227739925 AACAGGCAGGGACACCGTGAGGG + Intronic
1066292706 10:34028684-34028706 AGCCAGCCGGGGCAACGTAATGG + Intergenic
1067051930 10:43026611-43026633 AGCAAGCTGGGTCACCCTGAGGG - Intergenic
1067702378 10:48583214-48583236 AGGCAGCTGGGACACCAGGATGG - Intronic
1069280701 10:66650921-66650943 AGCCAGCGGTGGCAACGTGTTGG - Intronic
1074469649 10:113715399-113715421 GGCCAGCAGGGACACCCTGAAGG + Intronic
1077044308 11:537711-537733 AGCCATCGGGGACCCAGTGATGG + Intronic
1077562273 11:3271339-3271361 AGCCTCCAGGGGCACCGTGAAGG - Intergenic
1077568167 11:3317159-3317181 AGCCTCCAGGGGCACCGTGAAGG - Intergenic
1077570795 11:3337345-3337367 AGGCAGCAGGGACACAGGGAAGG + Intergenic
1082044735 11:47715445-47715467 AGGGAGCGGGGACCCCGGGAAGG + Intergenic
1082160459 11:48883505-48883527 AGCCAGTGGGGACAGTGTGGTGG - Intergenic
1082161907 11:48896901-48896923 AGCCAGTGGGGACAGTGTGGTGG + Intergenic
1082657110 11:55869295-55869317 AGCCAGTGGGGACAGTGTGGTGG + Intergenic
1085295624 11:75430117-75430139 GGCCAGCGGGGCCAGCGAGAAGG + Exonic
1087171512 11:95054079-95054101 ACCCAGTGGGGACTCCGTGTGGG - Intergenic
1090211331 11:124922872-124922894 ATCCAGTGGGGACACAGGGAGGG + Intronic
1094204346 12:27824825-27824847 AGCCAGGGTGGAGACCGGGACGG - Intergenic
1097288030 12:57892629-57892651 AGCTTGCGGGGACACAATGATGG + Intergenic
1099568119 12:84278650-84278672 CACCAGCGGGGACTCCGTGAAGG + Intergenic
1099980010 12:89588172-89588194 AGCCAACTGAGATACCGTGATGG - Exonic
1104167673 12:126249703-126249725 AGCCAAGGTGGGCACCGTGAAGG - Intergenic
1105207399 13:18235360-18235382 CGCTAGCGGGGACGCCGTCAAGG + Intergenic
1106382809 13:29256431-29256453 AGCCAGAGGGGCCACAGAGAGGG + Intronic
1107560225 13:41551488-41551510 AGTCAGCGAGGACACAGAGAAGG - Intergenic
1110629848 13:77696252-77696274 AGCAAGCTGGGACACAGGGAAGG + Intergenic
1114031222 14:18582918-18582940 AGACCCCGGGGACACCGCGAAGG - Intergenic
1124376664 15:29133048-29133070 AGCCAGCAGGGGCACCGGGCAGG - Intronic
1124930436 15:34114519-34114541 AGACAGCGGGCACACAGGGATGG - Intergenic
1132117737 15:99149850-99149872 AGCCAGCAGTGACAGTGTGAAGG + Intronic
1132634353 16:936165-936187 AGACAGAGGGGGCACCGTGTGGG + Intronic
1134020539 16:10918420-10918442 AGACTGCGGGGACACAGTGAGGG - Exonic
1135219580 16:20602347-20602369 AACCACCGGGGACCCCGAGATGG - Intergenic
1138456387 16:57123472-57123494 AGCCAGCGGGGAGAGCCTTACGG - Exonic
1139938936 16:70590956-70590978 AGCCAGCGCTGACAGTGTGAAGG - Intronic
1142093190 16:88226047-88226069 CACCAGCGGGGCCACTGTGACGG - Intergenic
1143830333 17:9645774-9645796 CCCCAGCCGGGACACTGTGATGG + Exonic
1143999992 17:11044763-11044785 AGCCACCGGGGACTTCTTGAAGG - Intergenic
1152475536 17:80515586-80515608 AACCAGCGGCCACACCGGGAGGG - Intergenic
1152584179 17:81181774-81181796 GGCCAGCGGGGACCCGGTGGGGG - Intergenic
1160145708 18:76362426-76362448 AGGCTGCTGGGACATCGTGAGGG + Exonic
1160782639 19:884600-884622 AGCCAGCGGGGACACCGTGAGGG - Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161967600 19:7556946-7556968 AGCCTGCGGGGATGGCGTGAGGG - Intronic
1162345019 19:10113849-10113871 GGCCAGCGGGGGCAGCGTCAGGG - Exonic
1162745000 19:12793134-12793156 AGCCCGCGGGGACATTGGGAAGG + Exonic
1163766245 19:19165040-19165062 AGCCAGCAGGGACCCCGAGATGG + Intronic
1164981563 19:32618500-32618522 TGCTAGCTGGGACACCATGAGGG + Intronic
1165428809 19:35759965-35759987 TGACAGCGGGGACTCCGTGGTGG + Exonic
1167793296 19:51693519-51693541 AGCCAGCAGGGCCATCGTGTGGG - Intergenic
925090986 2:1155959-1155981 AGACAGAGGGGACACCCAGAAGG + Intronic
925706147 2:6686057-6686079 AGCCAGAGGGGACAACGAGCCGG + Intergenic
931176361 2:59858817-59858839 AGCCACCGGGGATACCGCCATGG + Intergenic
936043927 2:109171737-109171759 AGCCAGCGTGGGCACCAGGAGGG - Intronic
938080601 2:128367986-128368008 AGCCCACGGGGGCACTGTGAGGG + Intergenic
938112782 2:128580044-128580066 AGGCAGCCGGGACACCCGGATGG - Intergenic
938210895 2:129464935-129464957 AGCCAGCGCGGGCATCTTGAAGG - Intergenic
938251714 2:129820993-129821015 AGCCATCGGAGACACCTTGATGG - Intergenic
938461441 2:131500251-131500273 AGCCAACGAGGACACCGTCTAGG - Intergenic
938496965 2:131802797-131802819 AGACTCCGGGGACACCGCGAAGG + Intergenic
938498020 2:131813478-131813500 AGCCCCAGGGGACTCCGTGAAGG - Intergenic
938548933 2:132361646-132361668 AGCCAGCAGGGACACAGAGGCGG - Intergenic
938566304 2:132522085-132522107 AGCCGGCGGGGCCACAGGGAAGG - Intronic
942047005 2:172105486-172105508 AGCAAGCGGGGAGAGTGTGAGGG + Intergenic
946391240 2:219418191-219418213 AGCCAGCGGGGGTCCTGTGACGG - Intergenic
947612089 2:231530754-231530776 AGGCCGCAGGGACACCGTGACGG - Intergenic
947929282 2:233950094-233950116 AGGCAGCCGGGACACCGTGCGGG - Exonic
948429696 2:237911713-237911735 CACCAGCAGGGTCACCGTGATGG - Exonic
1169758881 20:9069320-9069342 GCCCAGCGGGGACCCCGTGCAGG + Intronic
1179982916 21:44905791-44905813 AGGCAGCTGGGAGACAGTGAGGG - Intronic
1180455334 22:15509976-15509998 AGACCCCGGGGACACCGCGAAGG - Intergenic
1180882777 22:19218247-19218269 AGCCACCTGGTACACCTTGAAGG - Intronic
1181828904 22:25543169-25543191 AGGCAGCGGGGACACCAGCACGG - Intergenic
1181994010 22:26860546-26860568 AGCCAGCGGGGGCGACGTGGTGG + Intergenic
955874495 3:63475719-63475741 AGCCTGAGGGGACAGTGTGAGGG - Intronic
964644888 3:158948490-158948512 AGCCAGCATCAACACCGTGATGG - Intergenic
984998421 4:185460679-185460701 AGTCAGTGTGGACACAGTGATGG + Intronic
986733861 5:10653942-10653964 AGCCAGAGGGGGCACTGTGGTGG - Intergenic
995244515 5:109921112-109921134 AGACAGCAGGGACACCCAGATGG + Intergenic
999138205 5:149337991-149338013 AGCGAGCGTGGAAACCATGAAGG + Intronic
1001845617 5:174918219-174918241 GGCCAGCGGGGACAGGGTGCAGG - Intergenic
1006171731 6:32097071-32097093 AGCCAGAGGGGACGCTGTGAGGG - Intronic
1010986628 6:82432650-82432672 AGCCACCAAGGACACCATGAGGG + Intergenic
1017810804 6:157982068-157982090 ACCCAGCGTGGCCACCGTGCCGG - Exonic
1018516084 6:164581444-164581466 CCCCAGTGGGGACACCGTGTGGG + Intergenic
1021359284 7:19691803-19691825 AGCCAGCAGCGACAACGTGCTGG - Intergenic
1023391819 7:39718245-39718267 AGCCAGAGGGAATACTGTGAAGG - Intergenic
1024520857 7:50303759-50303781 CGCCAGCGGGGCGAGCGTGAGGG + Intergenic
1034086805 7:148329339-148329361 AGCCACCGGGGACTTCTTGATGG - Intronic
1034268188 7:149791219-149791241 AGCCAGCGGGGCCTCCCTCAGGG - Intergenic
1035163206 7:156966516-156966538 AGCCAGCGTGGACCAGGTGACGG - Intronic
1035165938 7:156989956-156989978 TGCCTGCGGGGAGACCGTGCTGG + Intergenic
1040386175 8:46916396-46916418 AGCCAGCGGGGCCAGGGTGTGGG + Intergenic
1041016474 8:53596935-53596957 AGCCAGTGGGGGCAGCTTGAGGG - Intergenic
1049814393 8:144591414-144591436 AGGTAGCAGGGCCACCGTGAAGG + Intronic
1050358437 9:4804734-4804756 CGCCAGCGAGGACACGGTGGCGG + Intronic
1053751965 9:41266264-41266286 AGCCAGCAGGGACACAGAGGTGG + Intergenic
1054257488 9:62830594-62830616 AGCCAGCAGGGACACAGAGGTGG + Intergenic
1054351084 9:64017164-64017186 AGACCCCGGGGACACCGCGAAGG + Intergenic
1059769812 9:117414717-117414739 GGGCAGTGTGGACACCGTGACGG + Exonic
1060442834 9:123657298-123657320 AGCCAGCAGGGACAGCTAGAAGG - Intronic
1061497864 9:130985912-130985934 AGCCAGGTGGGACACTTTGAAGG + Intergenic
1185461587 X:335157-335179 AGCAGGCGTGGACACGGTGAAGG + Intronic
1188792974 X:34426483-34426505 AGCCTGTGGGAACACTGTGAGGG - Intergenic
1194001974 X:88441782-88441804 AGCCAGAGAGGACAGGGTGAAGG - Intergenic
1196118038 X:112018232-112018254 AGATAGCAGGGACACCATGATGG - Intronic
1196741227 X:119027832-119027854 AGCCAGCAGGGACAACCTGCTGG - Intergenic
1199470010 X:148184247-148184269 AGCCAGAGGGAACTTCGTGAAGG - Intergenic