ID: 1160782769

View in Genome Browser
Species Human (GRCh38)
Location 19:885158-885180
Sequence TTGGGCTCTGGGGACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 503}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782769_1160782778 8 Left 1160782769 19:885158-885180 CCAGGCCTGTCCCCAGAGCCCAA 0: 1
1: 0
2: 6
3: 57
4: 503
Right 1160782778 19:885189-885211 CACAGGAACGCAAATGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1160782769_1160782774 -9 Left 1160782769 19:885158-885180 CCAGGCCTGTCCCCAGAGCCCAA 0: 1
1: 0
2: 6
3: 57
4: 503
Right 1160782774 19:885172-885194 AGAGCCCAACATCCACTCACAGG 0: 1
1: 0
2: 0
3: 7
4: 116
1160782769_1160782784 27 Left 1160782769 19:885158-885180 CCAGGCCTGTCCCCAGAGCCCAA 0: 1
1: 0
2: 6
3: 57
4: 503
Right 1160782784 19:885208-885230 CCGGATGGTGCCCTCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 104
1160782769_1160782782 26 Left 1160782769 19:885158-885180 CCAGGCCTGTCCCCAGAGCCCAA 0: 1
1: 0
2: 6
3: 57
4: 503
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782769_1160782779 12 Left 1160782769 19:885158-885180 CCAGGCCTGTCCCCAGAGCCCAA 0: 1
1: 0
2: 6
3: 57
4: 503
Right 1160782779 19:885193-885215 GGAACGCAAATGTCCCCGGATGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782769 Original CRISPR TTGGGCTCTGGGGACAGGCC TGG (reversed) Intronic