ID: 1160782770

View in Genome Browser
Species Human (GRCh38)
Location 19:885163-885185
Sequence GGATGTTGGGCTCTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782770_1160782778 3 Left 1160782770 19:885163-885185 CCTGTCCCCAGAGCCCAACATCC 0: 1
1: 0
2: 5
3: 39
4: 324
Right 1160782778 19:885189-885211 CACAGGAACGCAAATGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1160782770_1160782782 21 Left 1160782770 19:885163-885185 CCTGTCCCCAGAGCCCAACATCC 0: 1
1: 0
2: 5
3: 39
4: 324
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782770_1160782779 7 Left 1160782770 19:885163-885185 CCTGTCCCCAGAGCCCAACATCC 0: 1
1: 0
2: 5
3: 39
4: 324
Right 1160782779 19:885193-885215 GGAACGCAAATGTCCCCGGATGG 0: 1
1: 0
2: 0
3: 6
4: 61
1160782770_1160782784 22 Left 1160782770 19:885163-885185 CCTGTCCCCAGAGCCCAACATCC 0: 1
1: 0
2: 5
3: 39
4: 324
Right 1160782784 19:885208-885230 CCGGATGGTGCCCTCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782770 Original CRISPR GGATGTTGGGCTCTGGGGAC AGG (reversed) Intronic