ID: 1160782771 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:885168-885190 |
Sequence | TGAGTGGATGTTGGGCTCTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 296 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 27, 4: 266} |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160782771_1160782788 | 28 | Left | 1160782771 | 19:885168-885190 | CCCCAGAGCCCAACATCCACTCA | 0: 1 1: 0 2: 2 3: 27 4: 266 |
||
Right | 1160782788 | 19:885219-885241 | CCTCCCACAGGGACAGCAAAGGG | No data | ||||
1160782771_1160782779 | 2 | Left | 1160782771 | 19:885168-885190 | CCCCAGAGCCCAACATCCACTCA | 0: 1 1: 0 2: 2 3: 27 4: 266 |
||
Right | 1160782779 | 19:885193-885215 | GGAACGCAAATGTCCCCGGATGG | 0: 1 1: 0 2: 0 3: 6 4: 61 |
||||
1160782771_1160782782 | 16 | Left | 1160782771 | 19:885168-885190 | CCCCAGAGCCCAACATCCACTCA | 0: 1 1: 0 2: 2 3: 27 4: 266 |
||
Right | 1160782782 | 19:885207-885229 | CCCGGATGGTGCCCTCCCACAGG | 0: 1 1: 0 2: 1 3: 5 4: 105 |
||||
1160782771_1160782778 | -2 | Left | 1160782771 | 19:885168-885190 | CCCCAGAGCCCAACATCCACTCA | 0: 1 1: 0 2: 2 3: 27 4: 266 |
||
Right | 1160782778 | 19:885189-885211 | CACAGGAACGCAAATGTCCCCGG | 0: 1 1: 0 2: 0 3: 9 4: 113 |
||||
1160782771_1160782784 | 17 | Left | 1160782771 | 19:885168-885190 | CCCCAGAGCCCAACATCCACTCA | 0: 1 1: 0 2: 2 3: 27 4: 266 |
||
Right | 1160782784 | 19:885208-885230 | CCGGATGGTGCCCTCCCACAGGG | 0: 1 1: 0 2: 0 3: 18 4: 104 |
||||
1160782771_1160782786 | 27 | Left | 1160782771 | 19:885168-885190 | CCCCAGAGCCCAACATCCACTCA | 0: 1 1: 0 2: 2 3: 27 4: 266 |
||
Right | 1160782786 | 19:885218-885240 | CCCTCCCACAGGGACAGCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160782771 | Original CRISPR | TGAGTGGATGTTGGGCTCTG GGG (reversed) | Intronic | ||