ID: 1160782771

View in Genome Browser
Species Human (GRCh38)
Location 19:885168-885190
Sequence TGAGTGGATGTTGGGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782771_1160782788 28 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782788 19:885219-885241 CCTCCCACAGGGACAGCAAAGGG No data
1160782771_1160782779 2 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782779 19:885193-885215 GGAACGCAAATGTCCCCGGATGG 0: 1
1: 0
2: 0
3: 6
4: 61
1160782771_1160782782 16 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782771_1160782778 -2 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782778 19:885189-885211 CACAGGAACGCAAATGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1160782771_1160782784 17 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782784 19:885208-885230 CCGGATGGTGCCCTCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 104
1160782771_1160782786 27 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782786 19:885218-885240 CCCTCCCACAGGGACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782771 Original CRISPR TGAGTGGATGTTGGGCTCTG GGG (reversed) Intronic