ID: 1160782772

View in Genome Browser
Species Human (GRCh38)
Location 19:885169-885191
Sequence GTGAGTGGATGTTGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782772_1160782782 15 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782772_1160782779 1 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782779 19:885193-885215 GGAACGCAAATGTCCCCGGATGG 0: 1
1: 0
2: 0
3: 6
4: 61
1160782772_1160782786 26 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782786 19:885218-885240 CCCTCCCACAGGGACAGCAAAGG No data
1160782772_1160782778 -3 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782778 19:885189-885211 CACAGGAACGCAAATGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1160782772_1160782784 16 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782784 19:885208-885230 CCGGATGGTGCCCTCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 104
1160782772_1160782788 27 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782788 19:885219-885241 CCTCCCACAGGGACAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782772 Original CRISPR GTGAGTGGATGTTGGGCTCT GGG (reversed) Intronic