ID: 1160782773

View in Genome Browser
Species Human (GRCh38)
Location 19:885170-885192
Sequence TGTGAGTGGATGTTGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782773_1160782784 15 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782784 19:885208-885230 CCGGATGGTGCCCTCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 104
1160782773_1160782779 0 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782779 19:885193-885215 GGAACGCAAATGTCCCCGGATGG 0: 1
1: 0
2: 0
3: 6
4: 61
1160782773_1160782786 25 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782786 19:885218-885240 CCCTCCCACAGGGACAGCAAAGG No data
1160782773_1160782778 -4 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782778 19:885189-885211 CACAGGAACGCAAATGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1160782773_1160782788 26 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782788 19:885219-885241 CCTCCCACAGGGACAGCAAAGGG No data
1160782773_1160782782 14 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782773 Original CRISPR TGTGAGTGGATGTTGGGCTC TGG (reversed) Intronic