ID: 1160782775

View in Genome Browser
Species Human (GRCh38)
Location 19:885176-885198
Sequence CGTTCCTGTGAGTGGATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782775_1160782782 8 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782775_1160782779 -6 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782779 19:885193-885215 GGAACGCAAATGTCCCCGGATGG 0: 1
1: 0
2: 0
3: 6
4: 61
1160782775_1160782786 19 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782786 19:885218-885240 CCCTCCCACAGGGACAGCAAAGG No data
1160782775_1160782788 20 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782788 19:885219-885241 CCTCCCACAGGGACAGCAAAGGG No data
1160782775_1160782791 27 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG No data
1160782775_1160782778 -10 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782778 19:885189-885211 CACAGGAACGCAAATGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1160782775_1160782784 9 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782784 19:885208-885230 CCGGATGGTGCCCTCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 104
1160782775_1160782792 28 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782792 19:885227-885249 AGGGACAGCAAAGGGACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782775 Original CRISPR CGTTCCTGTGAGTGGATGTT GGG (reversed) Intronic