ID: 1160782777

View in Genome Browser
Species Human (GRCh38)
Location 19:885184-885206
Sequence GACATTTGCGTTCCTGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782777_1160782786 11 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782786 19:885218-885240 CCCTCCCACAGGGACAGCAAAGG No data
1160782777_1160782784 1 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782784 19:885208-885230 CCGGATGGTGCCCTCCCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 104
1160782777_1160782788 12 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782788 19:885219-885241 CCTCCCACAGGGACAGCAAAGGG No data
1160782777_1160782791 19 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG No data
1160782777_1160782792 20 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782792 19:885227-885249 AGGGACAGCAAAGGGACACAGGG No data
1160782777_1160782782 0 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782777 Original CRISPR GACATTTGCGTTCCTGTGAG TGG (reversed) Intronic