ID: 1160782782

View in Genome Browser
Species Human (GRCh38)
Location 19:885207-885229
Sequence CCCGGATGGTGCCCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782777_1160782782 0 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782772_1160782782 15 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782775_1160782782 8 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782773_1160782782 14 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782770_1160782782 21 Left 1160782770 19:885163-885185 CCTGTCCCCAGAGCCCAACATCC 0: 1
1: 0
2: 5
3: 39
4: 324
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782771_1160782782 16 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782769_1160782782 26 Left 1160782769 19:885158-885180 CCAGGCCTGTCCCCAGAGCCCAA 0: 1
1: 0
2: 6
3: 57
4: 503
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782776_1160782782 7 Left 1160782776 19:885177-885199 CCAACATCCACTCACAGGAACGC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782768_1160782782 27 Left 1160782768 19:885157-885179 CCCAGGCCTGTCCCCAGAGCCCA 0: 1
1: 0
2: 9
3: 131
4: 728
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782782 Original CRISPR CCCGGATGGTGCCCTCCCAC AGG Intronic