ID: 1160782782

View in Genome Browser
Species Human (GRCh38)
Location 19:885207-885229
Sequence CCCGGATGGTGCCCTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160782768_1160782782 27 Left 1160782768 19:885157-885179 CCCAGGCCTGTCCCCAGAGCCCA 0: 1
1: 0
2: 9
3: 131
4: 728
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782777_1160782782 0 Left 1160782777 19:885184-885206 CCACTCACAGGAACGCAAATGTC 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782770_1160782782 21 Left 1160782770 19:885163-885185 CCTGTCCCCAGAGCCCAACATCC 0: 1
1: 0
2: 5
3: 39
4: 324
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782775_1160782782 8 Left 1160782775 19:885176-885198 CCCAACATCCACTCACAGGAACG 0: 1
1: 0
2: 0
3: 4
4: 142
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782771_1160782782 16 Left 1160782771 19:885168-885190 CCCCAGAGCCCAACATCCACTCA 0: 1
1: 0
2: 2
3: 27
4: 266
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782776_1160782782 7 Left 1160782776 19:885177-885199 CCAACATCCACTCACAGGAACGC 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782773_1160782782 14 Left 1160782773 19:885170-885192 CCAGAGCCCAACATCCACTCACA 0: 1
1: 0
2: 1
3: 20
4: 212
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782772_1160782782 15 Left 1160782772 19:885169-885191 CCCAGAGCCCAACATCCACTCAC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1160782769_1160782782 26 Left 1160782769 19:885158-885180 CCAGGCCTGTCCCCAGAGCCCAA 0: 1
1: 0
2: 6
3: 57
4: 503
Right 1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160782782 Original CRISPR CCCGGATGGTGCCCTCCCAC AGG Intronic
900394449 1:2447444-2447466 CTCCCAGGGTGCCCTCCCACTGG + Intronic
901316895 1:8315683-8315705 CCCAGGTGGTGCCTGCCCACGGG - Intergenic
901814270 1:11785053-11785075 CCCGGAAGGCCCCCTCCCGCAGG + Intronic
902822847 1:18954064-18954086 CCCGCCTGGTGCCTTGCCACAGG - Intronic
903134413 1:21300128-21300150 CCAGGATGCTGCTCACCCACTGG + Intronic
903186679 1:21633225-21633247 CCTGGATGGTGGTCTCCCAGTGG + Intronic
904125618 1:28236375-28236397 CCCGGATGGAGCCCGCGCCCCGG - Exonic
904199958 1:28813028-28813050 CCTGCACGGTGCCCTCACACCGG - Intronic
905630507 1:39515546-39515568 CCCGGATGGCGCGCTCCAAAAGG - Intronic
905667254 1:39770643-39770665 CCCGGATGGCGCGCTCCAAAAGG + Exonic
912963592 1:114217482-114217504 CCCTGATAGTGCCCTGCAACCGG - Intergenic
922705926 1:227789939-227789961 CCCGGATGGTGCCTCCACACAGG - Intergenic
922818737 1:228469992-228470014 CCAGGCTGGTGCCCTCGCCCGGG - Intergenic
1065417545 10:25504583-25504605 GCCCGCTGGAGCCCTCCCACTGG + Intronic
1065590714 10:27258934-27258956 CCGGGTTTGTGCCCTCCCTCGGG - Intergenic
1065925855 10:30433677-30433699 CCGGGAGCGTGCCCTCCCGCCGG + Intergenic
1069812965 10:71175932-71175954 CCCGGGAGGTGCCCCCTCACTGG - Intergenic
1070605264 10:77893925-77893947 CCCGCATGGGGCCTTCCCACAGG + Intronic
1072806320 10:98425832-98425854 CCAGGTTGATGCCCTGCCACAGG + Exonic
1073352939 10:102832575-102832597 CTCGGATGGTGGCCTCCAGCAGG + Exonic
1075710841 10:124529863-124529885 CTGGGATCCTGCCCTCCCACAGG - Intronic
1076995990 11:297817-297839 CGCAGATGGAGCCCACCCACAGG + Intergenic
1079071488 11:17351701-17351723 CCCGGCCGGTGCCCGCCCCCGGG + Intergenic
1080099182 11:28439584-28439606 CCCGCATTGGGCCCACCCACAGG - Intergenic
1083228535 11:61300252-61300274 CCAAGAGGGTGCTCTCCCACAGG + Intronic
1084707661 11:70824668-70824690 CCATGTTGGTGCCCTCCCTCTGG + Intronic
1084982078 11:72834962-72834984 GCCAGATGATGCCCTCCCACTGG + Intronic
1089609307 11:119660643-119660665 GCCGGCTGGTGCCCTCCTAGGGG - Intronic
1091656137 12:2348162-2348184 TCCGGCTGGGGCCATCCCACTGG - Intronic
1091985457 12:4907698-4907720 GCCAGATGGTGCCCTTGCACTGG - Intergenic
1102532104 12:113554161-113554183 CTCCAACGGTGCCCTCCCACTGG - Intergenic
1105274336 13:18905913-18905935 CCCCAATAGTGCCCCCCCACCGG - Intergenic
1106004486 13:25756104-25756126 CCTGGATGGTGTCCTCACAGAGG + Intronic
1112328597 13:98460223-98460245 CCTGCATGGTGCCTTCCCAAAGG - Intronic
1113592443 13:111510705-111510727 CATGCCTGGTGCCCTCCCACGGG - Intergenic
1114938313 14:27573160-27573182 ACCAGATGGCCCCCTCCCACAGG - Intergenic
1118810381 14:69268869-69268891 CCGGGATGGTGCCCTGGCCCAGG - Intronic
1121121159 14:91376710-91376732 CCTGGATGGTGCCCTCCCATGGG + Intronic
1128313819 15:66647642-66647664 CCCGGCTGGCGGCCTCCCAAGGG - Intronic
1128797716 15:70477608-70477630 CCTGGATGCTGCCCTTCCCCAGG - Intergenic
1129868909 15:78928712-78928734 CCCTGAGGGTGGCCTCCCCCAGG - Intronic
1130991556 15:88878894-88878916 CCCAGAAGCTGCCCTCTCACAGG + Intronic
1131036607 15:89226614-89226636 CCCTCATGGTTCCTTCCCACGGG - Intergenic
1131318114 15:91358767-91358789 CTCTGATGTTTCCCTCCCACTGG + Intergenic
1132338995 15:101066215-101066237 CCTGGATGGTGCCCTCACCTCGG - Intronic
1132877746 16:2147968-2147990 CCCTGAGGGTCCCCTCCCACGGG - Intronic
1133230883 16:4365966-4365988 CCCGGATGCTGCCTGTCCACAGG - Intronic
1136071182 16:27788238-27788260 CCCGCATGGTCCCCTCCCCAGGG + Exonic
1139953851 16:70684349-70684371 CCCTCATGGTGCACTCCCCCTGG - Intronic
1141753476 16:85975444-85975466 CCAGGCTGGTGCCCTCCAACTGG - Intergenic
1147389298 17:40099487-40099509 CCCTGTAGGTGCCCTCCCTCGGG + Intronic
1150621468 17:66811158-66811180 GCTGGATGGTGCCCTTCCCCTGG + Intergenic
1154466029 18:14643168-14643190 CCCCAATAGTGCCCCCCCACTGG - Intergenic
1157491730 18:48128198-48128220 CCCGCAAGGTGCCCTCACTCTGG + Intronic
1158366707 18:56744772-56744794 CCCAGATGGTTCCCACCTACAGG + Intronic
1160782782 19:885207-885229 CCCGGATGGTGCCCTCCCACAGG + Intronic
1161772498 19:6238710-6238732 CCCAGATGGAGCCCTCCGCCAGG + Intronic
1162743417 19:12786181-12786203 CCCGGCAGGAGCCCTCCCCCAGG - Intronic
1162838399 19:13337128-13337150 ACAGCATGGTGCCCTCCCATTGG - Intronic
1165849325 19:38840265-38840287 CCCCGACGGTGACCCCCCACTGG + Exonic
1167077953 19:47260512-47260534 CCAGGATGGAGGCCACCCACTGG - Intronic
1167291765 19:48628735-48628757 CCGGGGTGGTGGCCACCCACTGG + Exonic
925194203 2:1910213-1910235 CACGGATGGTGCACTCCTGCTGG + Intronic
926113456 2:10196779-10196801 CCCGGCTGCGGCCCTCCCTCTGG - Intronic
927070393 2:19522936-19522958 CCCTGATAGTGCCCTCTCAAAGG + Intergenic
929614225 2:43295875-43295897 CCCAGATGGTGGCCTCCCTGGGG - Intronic
933784358 2:85827322-85827344 CCGAGATGGTCCACTCCCACGGG - Intergenic
935544698 2:104388505-104388527 CCCGGATGGAGCAATCCCATGGG - Intergenic
938164263 2:129012166-129012188 CAGGGATCGTGCCCTCCCCCAGG - Intergenic
946031564 2:216708933-216708955 CACGGATGGGGCTCTGCCACAGG + Intergenic
948895816 2:240926369-240926391 CCTGGATGTCTCCCTCCCACAGG - Intronic
1169046556 20:2538076-2538098 CCAGGACAGGGCCCTCCCACAGG - Intronic
1170697133 20:18669269-18669291 CCAGCAGGGTCCCCTCCCACTGG + Intronic
1172006869 20:31823934-31823956 GCCTGAAGGTGCCCTCCCCCAGG + Intronic
1172478675 20:35257696-35257718 CTGGGATGGTGCCCATCCACAGG - Intronic
1176808557 21:13515428-13515450 CCCCAATAGTGCCCCCCCACTGG + Intergenic
1181034971 22:20165501-20165523 CCAGGCTGCTGCGCTCCCACAGG - Intergenic
1181075725 22:20375470-20375492 CCCGTAAGATACCCTCCCACTGG - Exonic
1181508848 22:23379858-23379880 CCAGGCTGCTGCACTCCCACAGG + Intergenic
1185054234 22:48569730-48569752 CCCGGGGGGTGGCCTCCCGCAGG + Intronic
1185075108 22:48678862-48678884 CCGGGACGGTGCCCTGGCACCGG - Intronic
1203245112 22_KI270733v1_random:60494-60516 CCTGGATGGGGCCACCCCACTGG + Intergenic
950449331 3:13056744-13056766 CCCTGAGGGTGTCCTTCCACTGG + Intronic
953488294 3:43324180-43324202 TGAGGATGGGGCCCTCCCACAGG + Intronic
958047685 3:88304719-88304741 CCCTGATGTAGCCCTCTCACAGG - Intergenic
962754983 3:138459941-138459963 CCCGCAGGGTGCCCTGCAACTGG - Exonic
968665973 4:1822589-1822611 CATGCATGGTGCCCACCCACAGG - Intronic
970538684 4:17055842-17055864 CCTGCCTGATGCCCTCCCACAGG + Intergenic
972505606 4:39717550-39717572 CCCTAATGGTGCCATGCCACTGG + Intronic
989681139 5:44031461-44031483 CTCAGCTGATGCCCTCCCACAGG + Intergenic
998172504 5:139880877-139880899 CCCGGACGGTGTCCTTCCCCAGG + Exonic
1004864540 6:19838921-19838943 CCACGAGGGTGCCCTCCCTCGGG - Intronic
1005536342 6:26759822-26759844 CCCAAATGATGCCCTTCCACAGG + Intergenic
1006752584 6:36387861-36387883 CCCCGGTGCTGCGCTCCCACGGG - Intergenic
1007241972 6:40432750-40432772 CCCGGAGGGTGTCCTCCCCAAGG + Exonic
1008631080 6:53363526-53363548 CCCGCCTGGTGGGCTCCCACTGG - Intergenic
1011442022 6:87397727-87397749 CCAGGCTGGGGCACTCCCACAGG - Exonic
1018954228 6:168397244-168397266 CCTGGACGGTGCCCTCCTCCAGG + Intergenic
1019653183 7:2171825-2171847 CCTGCATGGTGCCCTCTTACTGG - Intronic
1029124665 7:98287848-98287870 CCCGGCTGGAGCCCGCCCATGGG - Intronic
1033329228 7:140404259-140404281 CCCCGATGATGTCCTCCCGCCGG - Intronic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1037632216 8:20668406-20668428 CGAGGATGCTGCCCTCCCATGGG + Intergenic
1047225686 8:122953820-122953842 CCCGGCTGCTGCCCTCTGACCGG - Exonic
1049319037 8:141986185-141986207 CCTGGACAGTGCCCTCCCAGGGG + Intergenic
1057214918 9:93222531-93222553 CCCAGATGCTGCCCTCCATCTGG - Intronic
1060409496 9:123390724-123390746 CCCGGATGGTCCACCCCCAGGGG + Intronic
1061862423 9:133474925-133474947 CCCGGCCGGCGCCCACCCACGGG - Intronic
1061985418 9:134127569-134127591 CCCAGATGGAGCCCTCCCTGAGG + Intergenic
1062043704 9:134415637-134415659 CTAGGATGGTGCCCTCCTAAGGG - Intronic
1062296168 9:135828302-135828324 CCTAGTGGGTGCCCTCCCACTGG - Intronic
1192738204 X:73869084-73869106 CCAGGAGAGTGCCCTCACACAGG + Intergenic