ID: 1160783901

View in Genome Browser
Species Human (GRCh38)
Location 19:891027-891049
Sequence CAGGGGCACCGATGGGCAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160783888_1160783901 20 Left 1160783888 19:890984-891006 CCATGGTGAAGGCGATGAGATTT 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG 0: 1
1: 0
2: 2
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160783901 Original CRISPR CAGGGGCACCGATGGGCAGT GGG Exonic
901089005 1:6629246-6629268 CAGGGGCACCCACGTGGAGTGGG + Intronic
901207417 1:7504959-7504981 CATGGGCACAGCTGGGCAGGAGG + Intronic
901207430 1:7505042-7505064 CATGGGCACAGCTGGGCAGGAGG + Intronic
901216938 1:7560271-7560293 CAGGGGACCTGAAGGGCAGTGGG - Intronic
901858232 1:12057714-12057736 CAGGGGCCTGGATAGGCAGTGGG + Intergenic
902940035 1:19794254-19794276 AAGGGGCTAGGATGGGCAGTGGG - Intronic
904592812 1:31624764-31624786 CAGGGGATCCGATGGCCAGGAGG + Intronic
904885304 1:33733263-33733285 AAGGGGCACAGGTGGGTAGTGGG - Intronic
905104984 1:35558771-35558793 CAGGGGGACAGCTGAGCAGTGGG + Intronic
906707175 1:47903368-47903390 CTGAGGCACAGCTGGGCAGTAGG - Intronic
906716307 1:47972233-47972255 CAGTGGCTCCCATGGGTAGTGGG - Intronic
907239938 1:53075773-53075795 AAGGGGCCCCGGTGGGCAGCAGG + Intronic
907558275 1:55364515-55364537 GAGAGGCACAGATGGACAGTAGG - Intergenic
916214216 1:162382158-162382180 CAGGAGCACAGCTGGCCAGTGGG + Exonic
920201639 1:204263213-204263235 CAGGGCCATTGATGGGGAGTGGG + Intronic
1062854088 10:770587-770609 CAGAGGCACCTCTGGGAAGTGGG + Intergenic
1062886928 10:1023656-1023678 CAGAGGCTGCGAAGGGCAGTGGG + Intronic
1064245876 10:13667297-13667319 AAGGGGCACAAATGGACAGTGGG + Intronic
1065177734 10:23095555-23095577 CAGGGGCAGAGACGGGCAGAGGG + Exonic
1067286163 10:44908975-44908997 CAGGAGCAGCACTGGGCAGTGGG - Intergenic
1069695261 10:70381611-70381633 CAGGGGCTCGGATGGGCAACCGG + Exonic
1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG + Intronic
1070771683 10:79085946-79085968 GAGTGGCAGAGATGGGCAGTGGG - Intronic
1071570891 10:86696256-86696278 CGGGGGCACCCATTGGCAGGAGG - Intronic
1072232615 10:93425928-93425950 CAGGGGCCCCGAGAGGCAGGTGG - Intronic
1073043096 10:100620723-100620745 CATGGTCACTGATGGGCAGGTGG + Intergenic
1073816450 10:107213128-107213150 CAGGGACACCAATGAGCTGTAGG + Intergenic
1075113767 10:119608925-119608947 CAGGAGCACTGAAGGGCAGCTGG + Intergenic
1075733170 10:124648300-124648322 GAGAGGGACAGATGGGCAGTGGG + Intronic
1076017905 10:127043658-127043680 CTGGGGCACAGACGGGCAGAGGG - Intronic
1076056988 10:127383856-127383878 CATGGGCACCTACGGGCAGGAGG - Intronic
1076810634 10:132884726-132884748 CAGGGGCCCCGATGGGCGGGTGG - Intronic
1077365715 11:2160757-2160779 CAGGGGCAGCAATGGGCAGTTGG + Intronic
1077506248 11:2931169-2931191 AAGAGGCACCTCTGGGCAGTGGG + Intergenic
1080414250 11:32054762-32054784 CAGCGACACAGATGGGCACTTGG + Intronic
1085018049 11:73188287-73188309 AAGGGGGATCGATGGGCAGGAGG - Intergenic
1085219174 11:74859107-74859129 CAGGGGCACAGATGGGAAGGTGG - Intronic
1085509984 11:77083280-77083302 CATGGGCACAGATGGACAGCAGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1088847137 11:113678060-113678082 CAGGGGCACCAATGAGCCATGGG - Intergenic
1089508158 11:118978904-118978926 CAGGGGCACCCAAAGCCAGTGGG + Intronic
1090934662 11:131330695-131330717 AAGGGGCACAGAGGGGCAGAAGG + Intergenic
1096464732 12:51842017-51842039 GAGGGGCACTGCTGGGCAGGTGG + Intergenic
1096537211 12:52282737-52282759 AGGGGTCACCGATGGGGAGTGGG - Intronic
1100614342 12:96219589-96219611 TAGGGGGACAGGTGGGCAGTGGG - Intronic
1102991833 12:117321540-117321562 CAGGGACACAGATGGGGAGAGGG + Intronic
1102992193 12:117323047-117323069 CAGGGGCACAGATGGAGAGAGGG - Intronic
1105541545 13:21320878-21320900 CAGAGGCCCCCACGGGCAGTGGG + Intergenic
1105829971 13:24155519-24155541 AAGTGGGACTGATGGGCAGTGGG + Intronic
1112689130 13:101870057-101870079 CAGGGGCATCTATGGTTAGTTGG + Intronic
1113465920 13:110512905-110512927 CAGGGACAACGTGGGGCAGTGGG - Exonic
1120930743 14:89845788-89845810 CAGGGAGACGGATGTGCAGTCGG + Intronic
1122355298 14:101119567-101119589 CAGGGGCAGAGCTGGGCAGTCGG + Intergenic
1122953980 14:105061411-105061433 CAGAGGCTCCCAGGGGCAGTAGG - Intronic
1124269041 15:28264228-28264250 CAGTGGCACAGCTGGGTAGTTGG - Intronic
1125301039 15:38253105-38253127 CAGCAGCACCGAGGGGCAGGAGG - Exonic
1127770124 15:62224255-62224277 CAGGGGCCCCGCTGGGCGGTGGG + Intergenic
1127960257 15:63885271-63885293 CTGGGGCAGCCCTGGGCAGTGGG - Intergenic
1130520494 15:84657748-84657770 AAGGGGCACCGGCTGGCAGTGGG + Intronic
1131619999 15:94058010-94058032 CAGGGGCAACGGTGGGCAGGAGG + Intergenic
1132467125 16:82488-82510 CTGGGGCACCGTGGGGCAGCTGG + Intronic
1132516270 16:367566-367588 GAGGGCCACCGGTGGGCAGTGGG - Exonic
1132601044 16:773109-773131 CAGGTGCACGGCTGGGCTGTGGG - Exonic
1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG + Intronic
1135989630 16:27210137-27210159 CAGGGGCTCTGCGGGGCAGTGGG - Exonic
1142902346 17:3019940-3019962 CACAGGCACCAATGGGCGGTTGG - Intronic
1145013524 17:19382841-19382863 CAGGCACACCAAAGGGCAGTGGG + Exonic
1146077395 17:29744092-29744114 CAGGGACGCCAAAGGGCAGTGGG + Intronic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1147610915 17:41801392-41801414 CATGGGCTCCCAGGGGCAGTGGG - Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149581758 17:57755644-57755666 CAGGGGCACTGCAGGCCAGTGGG - Intergenic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1151158011 17:72140501-72140523 CAGGGGCACAGAAGGTCAATGGG - Intergenic
1152191284 17:78889577-78889599 CAGGGGCACCCAAGGTCAGACGG - Intronic
1152419333 17:80183700-80183722 CAGGTGCACAGATGGGCCGGTGG - Intronic
1158526996 18:58223950-58223972 CAGGAGCACAGGTGGGCAGTGGG + Intronic
1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG + Exonic
1160866471 19:1258404-1258426 CAGGGGCACTGAGAGGCAGGGGG - Exonic
1161141524 19:2650987-2651009 CCTGGGCACCTATGGGCAGCTGG + Intronic
1161351721 19:3796650-3796672 CAGGATCACAGCTGGGCAGTAGG - Intronic
1161984844 19:7647477-7647499 CAGGGCCACCGAGGGCAAGTGGG + Exonic
1162298740 19:9831504-9831526 CAGGGGAACAGAGGGACAGTTGG - Intergenic
1164910390 19:32006414-32006436 CAGGGTCAGTAATGGGCAGTGGG - Intergenic
1165126398 19:33600915-33600937 CAGGGGCAGCTAGGGCCAGTTGG - Intergenic
1165476946 19:36036129-36036151 CTGGGGCACAGAGGGACAGTGGG - Intronic
1166333468 19:42091677-42091699 CAGTGGGACCGATGGGGAGATGG - Intronic
1166647172 19:44540877-44540899 CAGGGGCACTGAGGACCAGTGGG - Intergenic
1168130069 19:54312264-54312286 AAGGGCCACCCATGGGCAGCTGG - Intronic
1168317222 19:55489568-55489590 CCGGGGCAACGAGGGGCAGCTGG + Exonic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926724011 2:15983613-15983635 CAGGGCCCCCGATGTGCACTGGG - Intergenic
931630727 2:64296201-64296223 CAGGGGTGCTGATGAGCAGTGGG + Intergenic
932435190 2:71699250-71699272 CAGGGGCACCCACTGGCAGGAGG - Intergenic
935384421 2:102485896-102485918 CAGGGGCAGGCATGGGCAGAGGG + Intronic
937350271 2:121156025-121156047 CCGGGCCACCGTTGGGCACTGGG - Intergenic
938277308 2:130037928-130037950 CAGGGCCACGGAAGGGCAGCGGG - Intergenic
938438075 2:131299450-131299472 CAGGGCCACGGAAGGGCAGCGGG + Intronic
940449007 2:153814696-153814718 CAGGAGCATTGATTGGCAGTAGG - Intergenic
941928031 2:170915452-170915474 CAGAGGCCACCATGGGCAGTGGG + Intergenic
943702964 2:191006117-191006139 CAGGAGCAAAGATGGGCAGAAGG - Intronic
946408835 2:219506588-219506610 CAGGGGCACAGATGGGCAGGAGG + Intronic
946428364 2:219611878-219611900 AAGGGGCACTGATGGGGAGGTGG + Intronic
947953980 2:234171726-234171748 CAGGGGCACCGTAAGGCTGTGGG - Intergenic
948385357 2:237577494-237577516 CAGGTGCGCCCATGGCCAGTTGG - Intronic
948757173 2:240166551-240166573 TGGGGGCACCGGTGTGCAGTAGG - Intergenic
1175341015 20:58228814-58228836 CAGGGAGACCGATGGGCGGGCGG + Intergenic
1177608095 21:23408189-23408211 CAGGGGCACACATGGCCAGAGGG + Intergenic
1181006464 22:20016114-20016136 CAGGGGCACCGACGGCCCGGAGG - Intronic
1181031878 22:20152278-20152300 CAGGGGCAGTGAGGGGCAGCAGG - Intergenic
1181491734 22:23264445-23264467 CAGGAGCACAGTGGGGCAGTGGG - Intronic
1182043879 22:27259442-27259464 CTGGGGGAGCGATGGGCAGGAGG - Intergenic
1183439505 22:37815415-37815437 CAGGGGCACAGATGAGCTGCTGG + Exonic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1185337945 22:50279106-50279128 CAGCGGCACCCTTGGGCAGCAGG + Intronic
950407855 3:12815853-12815875 AAGGGGCACCTGTGGGCAGGAGG - Exonic
961870080 3:129981089-129981111 GAGGGGCAGCATTGGGCAGTTGG + Intergenic
966440835 3:179942500-179942522 CAGTGGCACCGGTAGGCACTCGG + Intronic
966658495 3:182386953-182386975 CAGGGACACAGATAGGCATTGGG - Intergenic
966778729 3:183565171-183565193 CAGGTGCACTGATGGGCCCTAGG + Intergenic
967296668 3:187971805-187971827 CAGGGGCAGCGATGTGCACCGGG + Intergenic
967387328 3:188924508-188924530 CAGGGGTCCTGATGGGCAGCTGG + Intergenic
968007598 3:195254010-195254032 CTGGTGCACAGCTGGGCAGTGGG - Intronic
968443148 4:634538-634560 CAGGGGCCCTGCTGGGCACTGGG - Intronic
968551606 4:1226324-1226346 CAGGGAGACGGATGGCCAGTCGG - Intronic
968623895 4:1617885-1617907 CAGGAGCACCCAGGAGCAGTCGG + Intergenic
968658563 4:1789332-1789354 CAGGGGGTCCCATGGGCAGAAGG + Intergenic
968830568 4:2931333-2931355 CAGGGGATCCGATGGGCAGCAGG - Intronic
969355502 4:6622967-6622989 CAGAGGCATGGATGTGCAGTGGG + Exonic
969457046 4:7306176-7306198 CAGGTGCAGCGGTGGGCACTGGG + Intronic
969538134 4:7769200-7769222 CAGAGGCTCCGACGGGCAGGTGG + Intronic
976778989 4:88737837-88737859 CAGGGGCAGCGATGGGAGGCAGG - Intronic
979103341 4:116651209-116651231 CAGGGACAGGGATGGACAGTTGG + Intergenic
992769571 5:80035105-80035127 TAGGGGCGAAGATGGGCAGTCGG - Intronic
992907011 5:81356737-81356759 TAGGGTCACCGATTGGCTGTGGG - Intronic
996892261 5:128435609-128435631 CAGGAGCACAGATGGACATTTGG + Intronic
997325438 5:133016834-133016856 CAGTGGCAACAATGGGCAATTGG - Intronic
1002043647 5:176530630-176530652 CAGGGGCACCGACGGGGAAAGGG + Exonic
1002902665 6:1423085-1423107 CAGAGGCACAGAGGGGCTGTGGG + Intergenic
1004278567 6:14259289-14259311 CAGGGGCTCCGGTGGGCAGCTGG + Intergenic
1005036639 6:21561389-21561411 CAGAGGCTACGAAGGGCAGTGGG - Intergenic
1005265447 6:24107615-24107637 CAGCTGCAGCCATGGGCAGTGGG - Intergenic
1005824625 6:29625320-29625342 GAGGGGCACTGAGGGGCTGTGGG - Intronic
1006682639 6:35808107-35808129 CCGGGGCAGGGGTGGGCAGTGGG + Intronic
1011750353 6:90449099-90449121 CAGAGGCACCAATGGGCAGATGG - Intergenic
1013590056 6:111612394-111612416 GAGGGGCACTGAGGGGCTGTGGG - Intergenic
1015289254 6:131520015-131520037 CAGGCACATCTATGGGCAGTTGG - Intergenic
1015786862 6:136927519-136927541 CAGGGGCCCAGTTGGGCACTAGG - Intergenic
1019500191 7:1360784-1360806 CAGCGGCACCGCTGTGAAGTGGG + Intergenic
1019665028 7:2247521-2247543 CAGGAGCAGCGATGGGAAGCAGG + Intronic
1022363448 7:29685326-29685348 CCGGCGCCCCGAGGGGCAGTCGG + Intergenic
1023563923 7:41504858-41504880 CAGGGGCACCGATCTGCACGGGG - Intergenic
1023854328 7:44172611-44172633 GAGGGGTACTGCTGGGCAGTAGG + Intronic
1024029053 7:45441241-45441263 CAGGGGCTGGGAAGGGCAGTGGG + Intergenic
1024426569 7:49232788-49232810 TGGGGGCAGTGATGGGCAGTGGG - Intergenic
1026636847 7:72090913-72090935 TAGGGGCAAGGATGGGTAGTGGG + Intronic
1026873187 7:73865548-73865570 CAGGGAGACAGATGGGCAGGTGG - Intronic
1031966940 7:128033159-128033181 CAGGGGTAGCGATTGGGAGTGGG + Intronic
1034452229 7:151143153-151143175 CAGGCACACAGAGGGGCAGTGGG - Intronic
1034736702 7:153435426-153435448 CAGGGGCATGGATGAGCAATGGG + Intergenic
1042077785 8:65015312-65015334 CAGGGGCAGAGGTGGGGAGTGGG - Intergenic
1047424991 8:124736939-124736961 CAGGGGAACAGAGGGGCAGGGGG + Intergenic
1049457854 8:142702949-142702971 CTGGGGCACCAAGGGGGAGTCGG - Intronic
1049639977 8:143711144-143711166 CAGAGGCACAGCTGGGCAGCTGG - Intronic
1053304553 9:36974929-36974951 CAGGGGCACTGGGGAGCAGTGGG - Intronic
1058382823 9:104396614-104396636 CAGGGGCAGCGAAGGGGAGATGG + Intergenic
1061074408 9:128332447-128332469 CAGGAGCCCTGAGGGGCAGTGGG - Intronic
1061289496 9:129642469-129642491 CAGGGGCGCCCAGGGCCAGTGGG - Intergenic
1061574822 9:131499610-131499632 CAGGGCCACCAATGTGTAGTTGG + Exonic
1061882617 9:133575619-133575641 CAGGGGCAGGGGTGGGCCGTGGG + Intergenic
1062094371 9:134695345-134695367 CGGGGGCAGCGAGGGGCAGCAGG - Intronic
1062189885 9:135242544-135242566 CAGGGGCACAGATGGCATGTGGG - Intergenic
1062646382 9:137550652-137550674 TAGGGGTACCGCTGGGGAGTGGG + Intergenic
1062646422 9:137550758-137550780 TAGGGGTACCGCTGGGGAGTGGG + Intergenic
1187652349 X:21422404-21422426 CAGGGGCAGGGATGTGCAGGGGG - Intronic
1187833947 X:23411858-23411880 CAGAGGCAGAGATGGGTAGTGGG + Intergenic
1188181178 X:27057843-27057865 CAGGGACACACATGAGCAGTGGG + Intergenic
1189160454 X:38804421-38804443 CCGGGGCAGCGATGGGGCGTGGG - Intronic
1197782650 X:130172619-130172641 CAGCGGCACCTGTGGGCAGAGGG + Intronic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200796533 Y:7346115-7346137 CAGGGACACCCATAGGCAGGGGG - Intergenic
1202025832 Y:20522333-20522355 CAGAGGCTCGGATGGGTAGTGGG - Intergenic