ID: 1160784307

View in Genome Browser
Species Human (GRCh38)
Location 19:892560-892582
Sequence GGATGGACCCTGGAGATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160784307 Original CRISPR GGATGGACCCTGGAGATTGG GGG (reversed) Intronic
902331253 1:15732177-15732199 GAATGGACCCTGGAGCTCAGAGG + Intronic
902768875 1:18634289-18634311 GGGTGGACACTGGAGAAGGGAGG - Exonic
903238110 1:21963829-21963851 GGATGGACCCCAGAGATCAGAGG - Intergenic
903262713 1:22139971-22139993 GGATGGAGCCTGGAGCTGGGAGG - Intronic
903537461 1:24076464-24076486 AGATGGAACCTGGTGATTGGTGG - Intronic
904002705 1:27347915-27347937 GGAGGGACCCTGGTGACTGGTGG - Intronic
904385604 1:30140208-30140230 GAATGGACTCTGGAGACTGAAGG + Intergenic
904609264 1:31716010-31716032 GGATAGGACCTGGAGATGGGGGG - Intergenic
905459744 1:38114792-38114814 GGCTGGACACTGGAGCTTAGAGG - Intergenic
907368231 1:53980125-53980147 TGATGCAGCCTGGAGCTTGGTGG - Intergenic
909947826 1:81683459-81683481 TGATGGACTTTGGAGATTTGGGG - Intronic
914201180 1:145487073-145487095 GGAGGGCCCCTGAAGATTGAGGG - Intergenic
914480294 1:148060205-148060227 GGAGGGCCCCTGAAGATTGAGGG - Intergenic
916476986 1:165179015-165179037 GAGTGGACCTTGGAGACTGGTGG - Intergenic
918109596 1:181443765-181443787 GAATGGATCCTGGAGTTTGACGG - Intronic
918571083 1:185993769-185993791 GGATGGACTATGTGGATTGGAGG - Intronic
919920995 1:202166311-202166333 GGATGGACGCTGCTGATTCGGGG + Intergenic
922801379 1:228366220-228366242 GGATGGCCCCAGGAGCTGGGGGG + Intronic
923920522 1:238559486-238559508 GAATGGGCCCTGGAGATGGAGGG + Intergenic
924449453 1:244164382-244164404 GGGTGGTCCCTGGGGATTGGTGG + Intergenic
924812494 1:247415771-247415793 GCATGGACTCTGGAGTTTGAAGG + Intergenic
1062978531 10:1702668-1702690 GCATGTACCCTGGGGAATGGGGG - Intronic
1064177493 10:13087553-13087575 GTCTGGACCCTGGAAATGGGCGG + Intronic
1071987147 10:91063319-91063341 AGAAGCACCCTGGAGATTGAGGG - Intergenic
1072199432 10:93145096-93145118 AGAAGGTCCCTGGAGATGGGTGG + Intergenic
1072240868 10:93494775-93494797 GGAGGGACCCTGGAGAGAGGTGG - Intergenic
1073116643 10:101095267-101095289 GGATTCACCTTGGAGATGGGAGG - Intronic
1074221047 10:111438277-111438299 GAAAGGCCCCTGGAGATTGGTGG - Intergenic
1076074658 10:127523527-127523549 GGATGAGCTTTGGAGATTGGGGG + Intergenic
1076426706 10:130372211-130372233 GGCTGGTCCCTGGAGATCTGGGG + Intergenic
1076515720 10:131043427-131043449 GGATGCAACCTGGAGGATGGAGG - Intergenic
1077344859 11:2042079-2042101 GGGTGGACGATGGAGAATGGAGG - Intergenic
1077649739 11:3959335-3959357 AGATGGACAGTGGATATTGGTGG + Intronic
1078095269 11:8292605-8292627 GGGCTGACCCTGGAGATTGGGGG + Intergenic
1079362279 11:19779003-19779025 GGATGGCTTCTGGAGCTTGGTGG + Intronic
1081490826 11:43567292-43567314 GGCTGGTCCCAGGAGATCGGAGG - Intronic
1081625427 11:44652489-44652511 TGATGGAGCCTGGAGATTGTGGG + Intergenic
1083202829 11:61130842-61130864 GGATGGACACTGGGGGTGGGAGG + Exonic
1083335373 11:61918727-61918749 GTATGGAATCTGGAGAGTGGAGG + Intronic
1083728770 11:64642372-64642394 TGATGGGAGCTGGAGATTGGAGG + Intronic
1084099233 11:66934568-66934590 GCATGGACCCTGGAGTCAGGCGG - Intronic
1086588590 11:88485162-88485184 GGCTGGACCCTGGAGTTTCCAGG + Intergenic
1089931378 11:122316721-122316743 GCATGGACAGTGGAGCTTGGTGG - Intergenic
1090930911 11:131297391-131297413 GGCTGGACTCTGGTTATTGGAGG - Intergenic
1092104144 12:5909022-5909044 GAAGGGGCCCTGGAGACTGGTGG + Intronic
1096101768 12:48973999-48974021 TGGGGGCCCCTGGAGATTGGGGG + Intergenic
1096676582 12:53229638-53229660 TGATGGAGCCAGGAGTTTGGGGG + Intronic
1096865250 12:54558726-54558748 AGATGGCACCTGGATATTGGTGG - Intronic
1098758973 12:74399930-74399952 GGATCGCCCTTGGAGAGTGGAGG - Intergenic
1102016380 12:109650729-109650751 GGAGTGGCTCTGGAGATTGGAGG - Intergenic
1102277880 12:111597873-111597895 GGCTGGACCCTGGAGATCCGGGG - Intronic
1102596138 12:113993885-113993907 GGAAGGACCCCTGAGAGTGGAGG - Intergenic
1102977518 12:117217262-117217284 GGATCGCCCCTGGAGCTAGGTGG - Intronic
1103781657 12:123402747-123402769 GTATTGACCCTCGGGATTGGAGG + Intronic
1103886806 12:124208472-124208494 GGGTGGTCTCTGGAGAGTGGGGG + Intronic
1104940615 12:132392880-132392902 GCGTGGACCCTGGAGCGTGGGGG + Intergenic
1107461604 13:40608896-40608918 TGATGGATCCTAGAGATAGGTGG + Intronic
1108379513 13:49842670-49842692 GCATGGACCTTGGAGGTTTGTGG + Intergenic
1112259394 13:97864335-97864357 GCATGGTCCCTAGAGATTTGTGG - Intergenic
1112277307 13:98033322-98033344 GGTTGAACCCTGGGAATTGGAGG + Intergenic
1113413409 13:110109590-110109612 CGAGGGACCCAGGAGATTTGTGG - Intergenic
1117049722 14:51848034-51848056 GGATGGACTCAAGAGAGTGGAGG - Intronic
1117916104 14:60679821-60679843 GCCTGGACCCTGGAGAAGGGAGG + Intergenic
1121097934 14:91230728-91230750 TGATGGACTCTGGTGATGGGAGG + Intergenic
1121520309 14:94581551-94581573 GGATGGACTCTAGAGTTTTGGGG + Intronic
1122916519 14:104861590-104861612 TGATGGACCCTGGAGATAGAGGG - Intergenic
1124201115 15:27679228-27679250 GGATGGACACTAAATATTGGGGG + Intergenic
1124632892 15:31347366-31347388 GGATGGGCAGTGGAGACTGGAGG + Intronic
1127791380 15:62401578-62401600 GGATGGGGCCTGGGCATTGGTGG + Intronic
1127995808 15:64152510-64152532 GGACAGACCCTGGTGAGTGGTGG - Intronic
1128233456 15:66051287-66051309 GGGTGGACCCTGGAGAGTCCTGG + Intronic
1128688637 15:69706515-69706537 GGATTTTCCCTGGAGAGTGGAGG + Intergenic
1129237824 15:74234350-74234372 GGCTGGCCCCTGGACATTTGAGG + Intergenic
1129328288 15:74813394-74813416 GGATGGAGCCGGGAGAGTGGAGG - Intronic
1130884493 15:88081783-88081805 GGCAGGGCCCTGGAGGTTGGGGG - Intronic
1131368062 15:91856088-91856110 GGCTGGCCCCAGGAGATAGGAGG + Intronic
1135006973 16:18834350-18834372 GGATGGAGCCTGGTTCTTGGAGG - Exonic
1136053914 16:27673697-27673719 GGATGTCCCCTGGAGTTGGGTGG + Intronic
1137674766 16:50298813-50298835 GGGTGCACCCTGGAGGGTGGGGG + Intronic
1137728547 16:50673367-50673389 GCAGGGACGCTGGAGATTTGGGG - Exonic
1137856588 16:51800591-51800613 GTATGGATCCTGGAGTTTGCTGG + Intergenic
1138057589 16:53851861-53851883 GGATGGAACTTGGGGATAGGTGG - Intronic
1140038607 16:71390243-71390265 GGATGGAACCTGGAAGTTTGGGG - Exonic
1140472825 16:75224737-75224759 GGATGGAGCCTGGACCCTGGTGG + Exonic
1140473639 16:75228017-75228039 GGATGGAGCCTGGACTCTGGAGG + Intergenic
1140860400 16:79012983-79013005 GGAAGAACCTGGGAGATTGGAGG + Intronic
1141506256 16:84480479-84480501 GGATGGCCCCTTGAGCCTGGGGG - Intronic
1143115759 17:4581144-4581166 GGATGGACAATGGAGAATGAGGG - Intergenic
1149222356 17:54429584-54429606 GGAGGGAACCAGGAGAGTGGAGG + Intergenic
1150131602 17:62672193-62672215 GGGTGGCACCTGGAGGTTGGGGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155030461 18:21979362-21979384 GGATGGAGCCTGCAGCTTTGAGG + Intergenic
1157395322 18:47336371-47336393 GGATGGAGACTGGAGACTCGAGG - Intergenic
1160784307 19:892560-892582 GGATGGACCCTGGAGATTGGGGG - Intronic
1160784356 19:892709-892731 GGGTGGAGCCTGGGGACTGGGGG - Intronic
1160788351 19:912150-912172 GGACGGACCCGGGAGTGTGGGGG + Intronic
1161068081 19:2248121-2248143 GGGTGGACCCCAGAGGTTGGTGG - Exonic
1161329145 19:3678174-3678196 GGATGGAGGATGGAGAATGGAGG + Intronic
1162337638 19:10071448-10071470 GGAGGGAGCCTGGACTTTGGAGG + Intergenic
1164856246 19:31526883-31526905 GGATGCCTGCTGGAGATTGGGGG + Intergenic
1164893054 19:31841189-31841211 TGATGGACTTTGGAGATTAGGGG - Intergenic
1166765209 19:45248788-45248810 GGGTGGACCCTGGAGTGTGTGGG + Intronic
1166956344 19:46468025-46468047 GGATGGAAGCTGGAGACTGAAGG + Exonic
1167261305 19:48460173-48460195 GCATGGACCCTGGAGCTGGATGG + Intronic
1167684976 19:50950429-50950451 GGCTGGAGCCTGGGGATGGGAGG + Intronic
927281192 2:21308316-21308338 GGATGGAACTTGGAGAATGATGG + Intergenic
928170262 2:28998851-28998873 TGTTGGACCCTGGAGATTGGTGG + Intronic
928179789 2:29060659-29060681 GGAAGGACCCTGGACACTGCAGG - Exonic
928210508 2:29320213-29320235 GGATGGACCCCGGAGAGGGGAGG + Intronic
929779111 2:44946459-44946481 GGATGGATGCTGGGGTTTGGCGG - Intergenic
932702519 2:74001542-74001564 TGATGGAGCCTGGAGTTTGTGGG + Intronic
933832180 2:86219903-86219925 GGCTATGCCCTGGAGATTGGGGG - Intronic
937981486 2:127618835-127618857 GGATGGAGCCTGGGGCTGGGAGG + Intronic
938099225 2:128486767-128486789 GCACGGAGCCTGGAGCTTGGTGG + Intergenic
940069456 2:149669304-149669326 GAAGGGAGCCTGCAGATTGGGGG + Intergenic
941083251 2:161087346-161087368 GGGTGGACCCTGGAGGTAGTAGG + Intergenic
944192895 2:197022487-197022509 GGAGGGAGCCAGGAGTTTGGGGG - Intronic
944321933 2:198356146-198356168 ACATGGAGCCTGGAGGTTGGAGG + Intronic
945176027 2:207044306-207044328 GGATGGAAACTGCATATTGGAGG + Intergenic
945975619 2:216268210-216268232 GGAAGGAACCTGGAGGTTGTCGG + Intronic
948258917 2:236588861-236588883 GGAAGGATCCTTTAGATTGGGGG + Intergenic
948557307 2:238822173-238822195 GGAAGGGCCCTGGAGACTGGAGG + Intergenic
1168801805 20:648275-648297 GCATGGATTCTGGAGATGGGTGG - Exonic
1169214225 20:3784339-3784361 GGATGGGCCCTGGAGGTTCCCGG - Exonic
1173753875 20:45497985-45498007 GGCTGGGCCCTGGACATTTGGGG - Intergenic
1175253361 20:57623014-57623036 GCATGGGCCCTGGAGATGGGGGG - Intergenic
1175444857 20:59013079-59013101 GCATGGTCCCTGCAGCTTGGAGG - Intergenic
1175721052 20:61287602-61287624 GGTGGGAGCCTGGAGTTTGGTGG + Intronic
1175932458 20:62499036-62499058 GGATGGCCGCTGGAGGGTGGGGG + Intergenic
1177171349 21:17659452-17659474 GAATGGACCCAGAAGATGGGAGG + Intergenic
1177733015 21:25053344-25053366 GGATAGACTTTGGAGATTGATGG - Intergenic
1179582414 21:42352057-42352079 GGATGGAGCCTGGAGGATGAGGG - Intergenic
1179582440 21:42352144-42352166 GGATGGGGCCTGGAGGATGGGGG - Intergenic
1179582519 21:42352385-42352407 GGATGGAGCCTGGAGGACGGGGG - Intergenic
1180649770 22:17368844-17368866 GGATGGAGGCTGGAGAGCGGCGG - Intronic
1183329555 22:37212065-37212087 GGATGTGTCCTGGAGATGGGGGG - Exonic
1184888027 22:47358696-47358718 GGCTGGACACTGTAGATTTGTGG + Intergenic
1185368529 22:50447845-50447867 GGATGCTCCCTGGAGTCTGGAGG - Intronic
1185380574 22:50505878-50505900 GGATGCACCCTGCAGGGTGGAGG - Intronic
949923265 3:9021107-9021129 GGATGGAACCTGGAGATGCTGGG - Intronic
949986643 3:9546407-9546429 TGGTGGACCCTGGAGGTGGGAGG - Intronic
953468263 3:43144193-43144215 ACAAGGATCCTGGAGATTGGTGG + Intergenic
953904537 3:46861867-46861889 GCATGCACTGTGGAGATTGGTGG - Intronic
954649061 3:52149159-52149181 GGAGGAACCCTGGGGGTTGGGGG - Intronic
963989157 3:151633466-151633488 GTATGGACCCTGAAGATAGGTGG + Intergenic
965899286 3:173618746-173618768 GGCTGAATCCTGGAGAGTGGTGG + Intronic
967946419 3:194807671-194807693 AGAGGGACCCTTGAGATGGGGGG + Intergenic
968554168 4:1238867-1238889 GGAGGGACCCAGGACACTGGAGG + Intronic
969503968 4:7571963-7571985 GGATGGAGCCTGGTGCCTGGAGG - Intronic
969632808 4:8348195-8348217 GGATGGGCTCTGGAGGCTGGAGG + Intergenic
969732315 4:8964352-8964374 CGGAGGACCCTGGAGATAGGAGG - Intergenic
972296399 4:37743406-37743428 GGATGGGTGATGGAGATTGGAGG + Intergenic
974664064 4:64935512-64935534 GGATGCACCCAGGAGAGTCGTGG - Intergenic
975739696 4:77417776-77417798 AGAGGGACCCAGGAGATTAGTGG - Intronic
976346745 4:84012484-84012506 GAATCGACCCTGGAGGTTAGCGG + Intergenic
978323116 4:107520088-107520110 GTGTGAACCCAGGAGATTGGAGG + Intergenic
984999011 4:185466465-185466487 GAATGGAATGTGGAGATTGGTGG + Intronic
989718661 5:44496963-44496985 GCATGGTTCCTGGAGATTTGGGG + Intergenic
993514047 5:88807305-88807327 GGTTTGACCCTGGAAAGTGGAGG - Intronic
995054353 5:107742925-107742947 GGTTGGACCTTGGAGTTTGGTGG + Intergenic
997607674 5:135186837-135186859 GGAAGGTCCCTGGGAATTGGAGG + Intronic
997723299 5:136098172-136098194 GGAGGGAGCAGGGAGATTGGGGG + Intergenic
1001745280 5:174087934-174087956 GGATTGACCCTAGAGAATTGAGG + Intronic
1001758607 5:174189461-174189483 GGATGGAAGTTGGAGATTTGGGG - Intronic
1010784249 6:79981651-79981673 GGATGGACCTAGGAAATAGGTGG + Intergenic
1018412099 6:163560446-163560468 GGATGGCCCCTGGAGAAGGAAGG + Intronic
1018910125 6:168096961-168096983 GGAAGCTCCCTGGAGAGTGGGGG + Intergenic
1020141523 7:5614617-5614639 GGCTGGACCCTGGAGAAGTGAGG + Intergenic
1020308969 7:6855094-6855116 CGGCGGACCCTGGAGATAGGAGG + Intergenic
1026898242 7:74022817-74022839 AGATGGAGCCTGGAGATAGTAGG - Intergenic
1029177394 7:98674723-98674745 GGATGGAAGCTGGAGGCTGGAGG + Intergenic
1034999722 7:155603193-155603215 GGGTGGTCTCTGGAGAGTGGAGG - Intergenic
1040460607 8:47644195-47644217 AGAAGGGCCCTGGAGATTGCAGG + Intronic
1040939550 8:52818353-52818375 GGATGGAGCTTTGAGATAGGAGG + Intergenic
1041774568 8:61509834-61509856 GGAGGGACCCTGGAGAAGGGAGG - Intronic
1045628115 8:104081194-104081216 GACTGGACCCTGGAGACTGTTGG - Intronic
1048049712 8:130805773-130805795 GCAGGGAGCCTGGAGAATGGTGG + Intronic
1048590752 8:135818536-135818558 GGAAGGTACCTGGAGAATGGTGG + Intergenic
1048876432 8:138840007-138840029 GAATAGACGCAGGAGATTGGAGG - Intronic
1051494111 9:17699549-17699571 GGATGGCAGCAGGAGATTGGTGG - Intronic
1053044881 9:34907243-34907265 GAATGGACCCAGGAGTTGGGAGG - Intergenic
1055422832 9:76162040-76162062 GTAGAGAGCCTGGAGATTGGAGG + Intronic
1057310636 9:93940841-93940863 GGAAGGACCCTGGGGAGTAGAGG - Intergenic
1059268265 9:113056240-113056262 GGAAGGACCGTGGGGGTTGGCGG - Intronic
1061767718 9:132892414-132892436 GCATGTACCCTGGAGAGTGAAGG + Exonic
1061873449 9:133532636-133532658 AGAGGGATCCTGGAGAGTGGGGG + Intronic
1062274315 9:135723610-135723632 AGAGGGACCCTGGGGCTTGGGGG + Intronic
1190000816 X:46684916-46684938 GGAGGGGCCCTGGAGATTCGTGG + Intronic
1191112169 X:56812456-56812478 GGAAGGACTCTGGAAATGGGAGG - Intergenic
1198036489 X:132805957-132805979 GGAAGGAGCCTGGAGATCTGAGG - Intronic
1199794226 X:151179413-151179435 GGAAGGAGGCTGGAGAGTGGGGG - Intronic
1200758040 Y:7009945-7009967 GGCTGGAACCTGGAAAGTGGAGG + Intronic
1201767557 Y:17586786-17586808 GGATGGTCCCTGTAGGCTGGGGG - Intergenic
1201833996 Y:18319199-18319221 GGATGGTCCCTGTAGGCTGGGGG + Intergenic