ID: 1160786263

View in Genome Browser
Species Human (GRCh38)
Location 19:901384-901406
Sequence TCCCCGTGTGGAGGGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160786253_1160786263 2 Left 1160786253 19:901359-901381 CCTGGCCGTAGGAGAACTGCCGG 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 225
1160786257_1160786263 -3 Left 1160786257 19:901364-901386 CCGTAGGAGAACTGCCGGGGTCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160786263 Original CRISPR TCCCCGTGTGGAGGGAGTGA GGG Intronic
901225863 1:7612666-7612688 TCACAGTGTGCATGGAGTGATGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902924783 1:19688973-19688995 TCCCTGTGAGGAGAGACTGAGGG + Intronic
904208111 1:28868059-28868081 TTCCCAGGAGGAGGGAGTGATGG + Intergenic
904575040 1:31499993-31500015 TCCACGTGGAGAGGGAGGGAGGG + Intergenic
904734856 1:32623898-32623920 TCCACGTGTTGTGGGAGGGAGGG + Intronic
909708798 1:78619829-78619851 TGCCAGTGTGGACTGAGTGAAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913291886 1:117281242-117281264 TCCCGGTGTGCAAGGAGGGAAGG - Intergenic
913478566 1:119262674-119262696 TTCCCGTCAGAAGGGAGTGAGGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915847616 1:159284265-159284287 TCCCAGTGTGGTGTGGGTGATGG - Intergenic
916119991 1:161520815-161520837 TCCCCTTGTGGTTGGAGTAAAGG + Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
920305464 1:205015544-205015566 TCCCCTTGTGCAGGGAGAGCTGG - Intronic
920528382 1:206685000-206685022 CCCCCGGGGGGAGGGAGGGAGGG + Intronic
920853187 1:209642943-209642965 TCCACGTGTGCAGGCACTGATGG + Intronic
922798298 1:228352304-228352326 TCCCCGTGTGTGGCTAGTGATGG - Intronic
923234392 1:232018731-232018753 TACCCGTGTGGAGGGACAGCAGG + Intronic
924229115 1:241948642-241948664 TTCCCGTGTAGAGGGAAGGAAGG + Intergenic
924777404 1:247119606-247119628 TCCTCCTGTGTAGGGAGTGTTGG - Intergenic
1062989253 10:1800160-1800182 TCCCATTGAGGAGGGAGTGAGGG + Intergenic
1070768515 10:79069595-79069617 CCCCCGGGTGTAGGGAGCGAGGG - Intronic
1071580959 10:86769872-86769894 TCCCAGTGTGGATGGAGGGGTGG + Intronic
1074686447 10:115966365-115966387 CCCACGTGTTGAGGGAGGGAGGG + Intergenic
1076838807 10:133034537-133034559 CTCCCGTGTGGAGGGAATGAGGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077439715 11:2562204-2562226 TCCCCGGGGGGTGGGGGTGAGGG + Intronic
1078030893 11:7749966-7749988 TCCAGGGGAGGAGGGAGTGAAGG + Intergenic
1079396336 11:20067009-20067031 TCCCCCTGTGGGAGGAGAGAGGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080964342 11:37196561-37196583 ACCCTTTGTGGAGGCAGTGAGGG - Intergenic
1081015189 11:37869383-37869405 TCTCAGAGTGGAAGGAGTGATGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081721967 11:45296199-45296221 TCTCCATGTAAAGGGAGTGAAGG - Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083282582 11:61636350-61636372 TCCAGGTGTGGATGGAGTGTGGG + Intergenic
1084289554 11:68153052-68153074 GCCCAGTGTGGCAGGAGTGAAGG - Intergenic
1084308308 11:68300656-68300678 TCCCCCTGTGGTGGGTCTGAGGG - Intergenic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1084838208 11:71821856-71821878 TCCACATGTGGATGGAGTCAGGG - Intergenic
1086536007 11:87847613-87847635 TCCCTGTGTGGAGTGAGTAGGGG + Intergenic
1087015743 11:93552933-93552955 TCCCCTAGTGAAGGGATTGAGGG + Intergenic
1089392513 11:118111763-118111785 CCCCCGTGTGGTGGGTGTGGAGG + Exonic
1092400495 12:8172227-8172249 TCCACATGTGGATGGAGTCAGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096567961 12:52496827-52496849 TCCCAGTGTGGAGGGAGGACAGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1100412920 12:94340313-94340335 TCTCTGTGTGGAGTGGGTGAAGG - Intronic
1101575688 12:105994304-105994326 TCCCCGAGAAGAGGGAGGGAAGG + Intergenic
1101850808 12:108400507-108400529 TCCCCGTGGGGAGGGAGGGAAGG - Intergenic
1101992859 12:109501523-109501545 TCCCAGTGAAGAGTGAGTGACGG + Exonic
1107333237 13:39324516-39324538 GCCCTGTGTGGACGGAGTGAGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1113233954 13:108248400-108248422 TTCCTCTGTGGAGGGAGGGAGGG + Intergenic
1113931718 13:113972271-113972293 ACCCCGTGGGGAGGGAGGTAGGG + Intergenic
1118386717 14:65261793-65261815 TCACATTGTGGAAGGAGTGAGGG + Intergenic
1119224533 14:72934667-72934689 TCCAGGTGTGGTGGGAGAGAAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122612101 14:102992123-102992145 GACCCCTGGGGAGGGAGTGATGG + Intronic
1122745287 14:103894147-103894169 AGCCCGTGTGGAGGGGGTGGGGG + Intergenic
1122874299 14:104656449-104656471 CCTCGGTGTGGAGGCAGTGAGGG + Intergenic
1125520384 15:40345044-40345066 ACCCCGGGTGGAGAGAGGGAGGG - Intergenic
1128263844 15:66251967-66251989 GCCCAGTCTGCAGGGAGTGACGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1132342087 15:101085252-101085274 CGCCTGTGTGGAGGGAGGGACGG - Intergenic
1132668114 16:1091053-1091075 CCCCTGTGGGGAGGGAGTGGGGG + Intronic
1132679321 16:1133270-1133292 CCCCCAGGTGAAGGGAGTGAGGG + Intergenic
1132907377 16:2289658-2289680 TCCCCGGGTGGGTGGAGGGAGGG + Intronic
1133060456 16:3171301-3171323 TCCGCGTGTGGTGGGCGAGAGGG - Intergenic
1133529467 16:6641326-6641348 TCAGCGTTGGGAGGGAGTGAAGG - Intronic
1136019059 16:27428417-27428439 TCCCCTTGTGGAGTCAGGGATGG + Intronic
1136645248 16:31608489-31608511 TCCCCTTCTGGAGTCAGTGAGGG + Intergenic
1137675368 16:50301300-50301322 CCCCCATGTGGAGGGAGAGGTGG + Intronic
1138520123 16:57566227-57566249 TCCCCATGGGGAGGAAGGGAAGG + Intronic
1141609783 16:85174821-85174843 GCCCCCTGGGGAGGGAGAGAGGG + Intronic
1142228721 16:88889454-88889476 TCCCCTTGGGGAGGGACTGAGGG + Intronic
1142273167 16:89101554-89101576 TCCAGGTGTAGAGGGATTGAGGG + Intronic
1142419529 16:89961888-89961910 TCCCCCTGGGGAGGGAGAGCAGG + Intronic
1142510322 17:388976-388998 TATCAGTGGGGAGGGAGTGAGGG - Intergenic
1142645173 17:1307088-1307110 TCCAGGTGTGGAAGGGGTGAAGG + Intergenic
1142934609 17:3317931-3317953 TCCCAGTGTGGAGAGAGCGGGGG - Intergenic
1143023503 17:3928513-3928535 TCACCAAGTGGAGGGTGTGAAGG - Intronic
1143445502 17:7006712-7006734 TTCCCGTGTGGAGGGAGGAAGGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146404452 17:32525242-32525264 TCCACGTGGGGAAGGAGAGAGGG - Intronic
1147610909 17:41801369-41801391 TCCCGGTGTGCAGGGTGTGCAGG - Intergenic
1150849260 17:68688878-68688900 TCCATCTGTGGAGGGAGGGAAGG - Intergenic
1151308437 17:73278957-73278979 CCCAAGTGTGGAGGGAGTGGGGG + Intergenic
1151369553 17:73639336-73639358 TCCCCGGGGGAAGGGAGAGAGGG - Intronic
1151805568 17:76402898-76402920 TCCCAGTGAGGAGGAAGTGGTGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152760701 17:82105735-82105757 TCCCCCTGTGGAGGGACCGTGGG - Intronic
1152928477 17:83098644-83098666 TCCTCATGTGGAGGGAGTCGAGG - Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1156085584 18:33396825-33396847 TCTATGTGTGGAGTGAGTGAAGG + Intronic
1157246206 18:46057212-46057234 GGCCCCTGTGGAGGGAGGGAGGG - Intronic
1157357756 18:46951116-46951138 TCTCCGTGTTGAGAGAATGAGGG - Intronic
1157559539 18:48636839-48636861 TCCCTGTGGGCAGGGAGTTAGGG - Intronic
1158553899 18:58459593-58459615 TCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1159370490 18:67521692-67521714 TCCTCATGTGGAGGAAGAGATGG - Intergenic
1159899036 18:74025114-74025136 TCCCTGTGAGGAGGGAGGGGAGG - Intergenic
1160483015 18:79260385-79260407 TCCCCGTGTGTAGAGGGAGATGG - Intronic
1160775986 19:855940-855962 TCCCCCTGTGGAGGCAGACAAGG - Exonic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1162018503 19:7858109-7858131 TCCCCCTGTGGCGGGAGGCAGGG + Intronic
1163012252 19:14433476-14433498 TCCCCGCGCGGAGGGAGGGGCGG - Intronic
1163045635 19:14639672-14639694 TCCCAGTGTGCAGGGATTGCAGG + Intronic
1163237218 19:16036841-16036863 GCCCGGTGTGGAAGGAGTTAGGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164309137 19:24030961-24030983 GCCCCATGTGGAGGAAGGGATGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1166753028 19:45173775-45173797 TCCCCAGGAGGAAGGAGTGAGGG + Intronic
1167177080 19:47872419-47872441 TCCCCGTGTGAGTAGAGTGACGG - Intronic
1167306938 19:48714872-48714894 TCCTGGTGGGCAGGGAGTGAGGG + Exonic
1168145279 19:54416745-54416767 TCCCCGTGTGTGGGGAGAGGGGG - Intronic
925164609 2:1708382-1708404 GCCCCCTGTGGATGGACTGAAGG + Intronic
926131805 2:10307813-10307835 TGCCGGTGTGGCTGGAGTGAAGG - Intronic
927510731 2:23642469-23642491 CCCACGTGGGGAGGCAGTGAGGG - Exonic
927595659 2:24394714-24394736 TACCCGTGTGGGTGCAGTGAGGG - Intergenic
929124765 2:38513078-38513100 TCCCTGTGTAGAGAGAGGGAGGG + Intergenic
930694203 2:54394699-54394721 CCCATGTGTGGAGGGAGGGAGGG - Intergenic
932572002 2:72943121-72943143 TGCCCGTGAGGAGGGGGAGAAGG - Exonic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
934575409 2:95397473-95397495 TGCCGGTGTGGAGGGTCTGAGGG + Intergenic
935562844 2:104576409-104576431 GCCCCGTGAGGTGGGTGTGACGG - Intergenic
937226872 2:120375293-120375315 TCTCCTTGGGGAGGCAGTGAGGG - Intergenic
937920015 2:127122294-127122316 TCTCCTTGGGGAGGCAGTGAGGG - Intergenic
938077113 2:128345903-128345925 TCCCCCTGTGGAGGAAGGCAAGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941111845 2:161424687-161424709 TCCCCGAGTGGATGGATGGATGG + Exonic
944224601 2:197337533-197337555 TCCCCTTGTGAATGGAATGAAGG + Intergenic
947153876 2:227141107-227141129 TGCCAGTGGGGAGGGAGTGGTGG + Intronic
948152897 2:235758515-235758537 TCAATGTGTGGAGGGGGTGAGGG - Intronic
948178318 2:235961180-235961202 TCCCCATGTGGAGAGAGCCACGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169950498 20:11038093-11038115 TCCCTGTGTGGAGGAACAGATGG - Intergenic
1170452312 20:16496172-16496194 TCCCCATCTGTAGGGAGAGAAGG - Intronic
1170498082 20:16946513-16946535 TCCTCGCCTGGAGGGAGAGAAGG + Intergenic
1171906865 20:30906416-30906438 TCGCCGGGTGGAGGGTGTGGTGG - Intergenic
1172009824 20:31840090-31840112 GCCCTGTGTGAAGGGAGAGATGG + Intergenic
1173259589 20:41421901-41421923 TCCCAGTCTGGTGGGAGTGTGGG - Exonic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173987655 20:47274971-47274993 TTCCTGTGTGAAGGGAGTGAGGG + Intronic
1174199683 20:48798525-48798547 TGCTGGTGTGGAGGGAGGGAAGG - Intronic
1174379266 20:50146298-50146320 GCCTCGTGTGGGGGGAGTGTGGG - Intronic
1174592957 20:51660944-51660966 TCCCCTTATGGAGGGAGGGAGGG + Intronic
1175332445 20:58174911-58174933 TGAACTTGTGGAGGGAGTGAGGG - Intergenic
1175618127 20:60420786-60420808 TCCAGGGGTAGAGGGAGTGAAGG - Intergenic
1176018928 20:62952885-62952907 TCCAGGTGTGGCGGGGGTGAGGG + Exonic
1176130792 20:63496029-63496051 TCCCCATCTGGAGCGGGTGAGGG + Exonic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1178904342 21:36624104-36624126 TCTCCATGTGTAGGGGGTGAAGG + Intergenic
1179359240 21:40689969-40689991 AGCCAGTGTGGAGGGAGGGAGGG + Intronic
1180080610 21:45486054-45486076 GCCCGGTGTGGGGGGCGTGAGGG - Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181983436 22:26782564-26782586 TCCCAGTGGGGAGGGAGTCTTGG + Intergenic
1182272345 22:29163096-29163118 CCCACGTGTTGAGGGAGGGAAGG + Intronic
1183293197 22:37015321-37015343 TCCCTTCTTGGAGGGAGTGAGGG - Intronic
1183465704 22:37979489-37979511 TTCCAGTGTGGTGGGACTGAGGG + Intronic
1183745987 22:39691909-39691931 TCCCAGTGAGAAGGGATTGAAGG - Intergenic
1184147234 22:42618958-42618980 TCCCCCTGTGCTGGGGGTGAGGG + Exonic
1184874894 22:47268109-47268131 TCCCTGTGTGGGTGGAGGGAAGG - Intergenic
1185058336 22:48592661-48592683 TCACTGAGAGGAGGGAGTGAGGG - Intronic
949538454 3:5013568-5013590 TCCACTTATGGAGGGAGGGAGGG - Intergenic
951171225 3:19543987-19544009 TCCCAGTGTGGAGGCATTGGAGG - Intergenic
952712220 3:36443209-36443231 TCCCTGTGTGGGTGGGGTGATGG - Intronic
952853090 3:37744929-37744951 ACCCTGTGTGGATGAAGTGAAGG + Intronic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
955433015 3:58870089-58870111 TCCCCTTGTAGAGGGAGGGAGGG - Intronic
955938771 3:64128217-64128239 TCCACGTGTGGAGAAAGCGATGG - Intronic
956871618 3:73423957-73423979 TCCCCGTGACGAGGAAGAGATGG + Intronic
957885531 3:86282501-86282523 GCCCACTGTGGAGGGAATGAGGG - Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
964945238 3:162214627-162214649 TCCACATGTGGAGTGAGTGGAGG - Intergenic
966126032 3:176577716-176577738 TCCCCGTGTGCAGGCAGTAACGG + Intergenic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
968522668 4:1041095-1041117 TGCCCCTGTGGAGGGTGGGAGGG + Intergenic
968973685 4:3810252-3810274 TCCCCCTGTGTAGGGAGGGTCGG + Intergenic
969531431 4:7733098-7733120 TCCTCTGGTGGAGAGAGTGAGGG - Intronic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
971447241 4:26764197-26764219 TCCAGGGGAGGAGGGAGTGAGGG - Intergenic
978776293 4:112509918-112509940 TCCCCGAGTGGAATGAGTGGGGG - Intergenic
984731874 4:183076003-183076025 TCCCCGTGAGGATGAACTGATGG - Intergenic
985947061 5:3194090-3194112 TCTCTGTGTAGAGGGAGGGATGG + Intergenic
994188319 5:96839670-96839692 TCCCTCTGAGCAGGGAGTGAAGG - Intronic
996410732 5:123156229-123156251 TCACCATGTGCACGGAGTGAAGG - Intronic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
997800962 5:136861635-136861657 TCCCTGGGTGGTGGGAGTGAGGG + Intergenic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1003133950 6:3418634-3418656 TCCCCCTGGGGAGGGGGTGCAGG + Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1004834964 6:19520578-19520600 TGCCCTTGTGGAAGGAGTAAGGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1008962031 6:57275828-57275850 TACCCGTTTGGTGGGATTGAAGG - Intergenic
1010624300 6:78117998-78118020 TCCCAGAGAGGAGGTAGTGAAGG - Intergenic
1017994566 6:159520994-159521016 TCCCAGTGGGAAGGGAGTGACGG - Intergenic
1018782192 6:167078292-167078314 TCCCTGTGAGGATGCAGTGAAGG - Intergenic
1020534534 7:9379166-9379188 TCACCCGGTGGAAGGAGTGAGGG - Intergenic
1022685325 7:32591138-32591160 TCCAGGTGAGGTGGGAGTGAGGG + Intergenic
1022903570 7:34834283-34834305 TCCCCGAGTGCAAGGTGTGAAGG - Intronic
1025142694 7:56479047-56479069 TCCCTGAGTGGAGGAAGAGAGGG + Intergenic
1025610717 7:63073537-63073559 TCCCTGAGTGGAGGAAGAGAGGG - Intergenic
1032179927 7:129666259-129666281 TACCCCAGTGGAGGGAGGGAGGG - Intronic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1034165639 7:149023065-149023087 TCCTGGTGTGGAGGGAGGGGTGG - Intronic
1034558223 7:151863175-151863197 TCCCCGGGTGCAGGGGGTGCTGG + Intronic
1035185830 7:157125372-157125394 TGCAAGTGTGGAGGGAGGGAGGG - Intergenic
1035359453 7:158300768-158300790 TGGCCGTGTGGAGGGAGGGGAGG + Intronic
1036277062 8:7363326-7363348 TCCACATGTGGATGGAGTCAGGG - Intronic
1036344272 8:7947020-7947042 TCCACATGTGGATGGAGTCAGGG + Intronic
1036839613 8:12107792-12107814 TCCACATGTGGATGGAGTCAGGG + Intronic
1036861405 8:12354032-12354054 TCCACATGTGGATGGAGTCAGGG + Intergenic
1037508858 8:19561623-19561645 TCCCCTTGTAAAGGGAGAGAAGG - Intronic
1037560164 8:20066194-20066216 GCCCCATGTGAAAGGAGTGATGG - Intergenic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047646388 8:126874765-126874787 TTCCCCTGTGGAGGAAGGGATGG + Intergenic
1047813581 8:128437092-128437114 GCCAAGTGAGGAGGGAGTGAGGG + Intergenic
1047958706 8:129995243-129995265 TCCCAGGGTGGCGGAAGTGAGGG + Intronic
1049867065 8:144946167-144946189 TCGCCGTGAGGAGGCAGAGATGG - Exonic
1052259759 9:26500522-26500544 TACCAGGGTGGAGGGAGTTAGGG + Intergenic
1053479088 9:38402763-38402785 TCACCGTGTGGATGGACTGACGG + Intergenic
1055963509 9:81843155-81843177 TCACAGGGTGGAGGGAGTTAGGG + Intergenic
1057280843 9:93710414-93710436 TCCCAGTGTGCAGCGAGTGGGGG + Intergenic
1058765814 9:108181685-108181707 TCCCAGAGTGGAGGCAGAGAGGG - Intergenic
1062581621 9:137231495-137231517 TCCCCCTGTGGATGGAGAAAGGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186862247 X:13684315-13684337 TACTCCTGTGGATGGAGTGAGGG + Intergenic
1190528517 X:51351815-51351837 TCCACGTGTTGTGGGAGGGACGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1194647496 X:96475293-96475315 TACAAGTGTGGAGGGAGTGGTGG - Intergenic
1195318937 X:103705546-103705568 TCACCATATGGAGGGAGGGAGGG + Intergenic
1196457703 X:115901720-115901742 TCACCGTGTTGGGGCAGTGAAGG + Intergenic
1197750306 X:129959449-129959471 TCCCCGTGTAGGGGGAGGCAGGG + Intergenic
1199903457 X:152200574-152200596 TCTCAGTGGGGAGAGAGTGAAGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic