ID: 1160787096

View in Genome Browser
Species Human (GRCh38)
Location 19:905723-905745
Sequence CAGGGCTGCCTGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160787096 Original CRISPR CAGGGCTGCCTGAAGCAGGA AGG Intronic
900120656 1:1047341-1047363 CAGGGCGTCCTGGAGCTGGAGGG + Exonic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900154727 1:1199323-1199345 CAGGGAGGGGTGAAGCAGGAGGG + Intergenic
900159255 1:1215777-1215799 CTGGGCAGCTTCAAGCAGGAGGG - Intergenic
900244867 1:1632176-1632198 CAGGGCTGCATGGGGCAGCAAGG - Exonic
900393220 1:2442914-2442936 CATGGCTGCCTGCAGCAGAGCGG + Intronic
901058961 1:6462909-6462931 CAGGGTGGCCCCAAGCAGGAGGG + Exonic
901688848 1:10959704-10959726 AAGGGCTTCCAGAAGCAGAAAGG + Intronic
901750491 1:11404134-11404156 CAGGGCAGCATGAAGAAGGTGGG + Intergenic
901931852 1:12601051-12601073 GAGGGCTGCCTGATACAGGCAGG + Intronic
902139397 1:14339954-14339976 GAGAGCTGCTTGAAGCAGCAGGG - Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902187368 1:14735422-14735444 CAGGGCTGCCTGGAAGAAGAAGG - Intronic
902219091 1:14953318-14953340 AAGGGCTTCCTGAACCAGCAGGG - Intronic
902832969 1:19029569-19029591 CATGGCTGCAGGAAGCAGGCTGG + Intergenic
902923893 1:19683138-19683160 CAGGGCTGGCAGCAGCAGGAAGG + Exonic
904284390 1:29444572-29444594 GAGGGCTGCCTGAAAGAGGTGGG + Intergenic
905008074 1:34727166-34727188 CAGTTCTTCCTGAAGCAGAAAGG - Intronic
905256157 1:36686788-36686810 GAGGGCTGCCTGGGGCAGGGTGG + Intergenic
905490045 1:38336278-38336300 CAGTGCTGGCTGAAGCATTAGGG + Intergenic
905520322 1:38594009-38594031 CAGGTCAGTCTGGAGCAGGATGG + Intergenic
906681400 1:47728132-47728154 CTGGGCTGCCTAAAGCAGCGTGG - Intergenic
908746345 1:67380342-67380364 GAAGGCTTCCTGAAGGAGGAAGG - Intronic
910100168 1:83567344-83567366 CAGGCTTGCCTGGAGCAGAAAGG + Intergenic
910101481 1:83582845-83582867 CAGGGCAGCCTGAAGCATGGGGG - Intergenic
912379497 1:109239749-109239771 CTGGGCTGCCCAAGGCAGGAGGG - Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
912930766 1:113958333-113958355 TAGAGCTGCCTAAAGCAGGTAGG - Intronic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915529750 1:156496560-156496582 AAGGGCTGACTGGAGCAGGAGGG - Intronic
916173305 1:162018120-162018142 AAGGGCTGCCTGATGGTGGAGGG + Intronic
916820910 1:168397833-168397855 CTGCGCTGCTTGAAGGAGGAAGG + Intergenic
917454446 1:175174050-175174072 CAGGACTGGGTGAAGCAGGCAGG - Intronic
917667457 1:177239127-177239149 CCGGGCTGCCTAAAGAAAGAAGG - Intronic
920173251 1:204084478-204084500 CAGGGCTGCCAGGACCAGGCAGG + Intronic
920588770 1:207196107-207196129 GAGGGCGAGCTGAAGCAGGATGG + Intergenic
921075393 1:211696640-211696662 CAGGGATGGCTGAGGCATGAGGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921890043 1:220344602-220344624 CAAGGCTGAATGAGGCAGGATGG + Intergenic
922179542 1:223223312-223223334 CAGGGTTGTCCGAAGCAGGGTGG + Exonic
922559856 1:226561420-226561442 CAGGGCTGCATGCAGAATGAGGG + Intronic
922775202 1:228211350-228211372 CAGGTCTGCCTGCCTCAGGAAGG + Intronic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1062895617 10:1101122-1101144 GAGGGCGGCCTGGAGCAGGGTGG - Intronic
1063018753 10:2104925-2104947 CAGGGCAGCCGGAGGCGGGAGGG + Intergenic
1063102741 10:2964553-2964575 CAGGACGTCTTGAAGCAGGAGGG - Intergenic
1063288443 10:4715070-4715092 CAGGGCTGCATGAAGCTGTGTGG - Intergenic
1064266254 10:13827851-13827873 CAGGGCTCCCCGAAGCAGGCAGG - Intronic
1064267680 10:13838191-13838213 CTGGGAAGCCTGAGGCAGGATGG - Intronic
1065220751 10:23493563-23493585 AAGGGCTGCATGAAGGAGGCTGG + Intergenic
1066393044 10:34994175-34994197 CAGGAATGACTGAAGCAGGCTGG - Intergenic
1067106732 10:43371568-43371590 CAGGGCTCCATGACGCAGGCTGG - Intergenic
1067211637 10:44264553-44264575 GAGGCCTGCGTGAAGCAGGATGG + Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1067429638 10:46234555-46234577 CAGGGCTGCCTGGAGAGGCAGGG - Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1069824518 10:71246889-71246911 CGGTGCTCCCTGAAGCAGGGAGG + Intronic
1069829491 10:71273826-71273848 CAGACTTGCCAGAAGCAGGAAGG + Intronic
1070032831 10:72693013-72693035 CACGCGTGCCTGAAGCGGGAAGG + Intronic
1070409420 10:76125719-76125741 CAGGACTGCATGCAGCTGGAGGG + Intronic
1070613759 10:77952977-77952999 CATGGGAGGCTGAAGCAGGAGGG + Intergenic
1070973014 10:80582801-80582823 CAGGACTGCCTGCAGCAAGCAGG - Intronic
1072046928 10:91666633-91666655 CAGACCTCCCTGAAGAAGGAGGG - Intergenic
1073009611 10:100349049-100349071 TAGGGGGGCCTGAAGCAGGCTGG - Intronic
1073094633 10:100972142-100972164 CGGGGGTGCCTTATGCAGGAGGG - Intronic
1074368047 10:112875956-112875978 CAGGGCTGCCAGGAGCAGGGAGG + Intergenic
1074816853 10:117148753-117148775 CTGGGCTGATGGAAGCAGGAAGG + Intergenic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1075021559 10:118956259-118956281 CAACTCTGCCTGAAGCAGGAGGG + Intergenic
1076045662 10:127292329-127292351 CAGGGCTGCCTGAGTCACTAAGG - Intronic
1076067902 10:127463720-127463742 CAGGGACCCCTGATGCAGGAAGG - Intergenic
1076420281 10:130326790-130326812 CAGGGTTGCGTTAAGCATGATGG - Intergenic
1076585716 10:131546267-131546289 CAGGGCTGGCTGAAGGAACATGG - Intergenic
1076817558 10:132922364-132922386 CAGGGCTGCCTGAAGCAAGGAGG - Intronic
1077048869 11:557843-557865 GAGGGCAGCCTGGGGCAGGAGGG + Intronic
1077111903 11:865657-865679 CAGGTCGGGCTGAGGCAGGAGGG - Intronic
1077150592 11:1071345-1071367 CAGGGTTGGCTGTGGCAGGATGG + Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077552593 11:3207734-3207756 AAAGGCTGCCTGCAGGAGGAGGG - Intergenic
1077737822 11:4809821-4809843 TAGAGCTCCCAGAAGCAGGAAGG - Intronic
1078043675 11:7893322-7893344 GAGGGCTGCCTGATCCAGGGAGG - Intergenic
1078153141 11:8776048-8776070 CAGGGCTGGCTGAAGAGGGAAGG - Intronic
1078358562 11:10650746-10650768 CTGGGCTGCCTGAGGCTGAAGGG + Intronic
1078565646 11:12411896-12411918 TGGGGGTGCCTGCAGCAGGAAGG - Intronic
1079078563 11:17398200-17398222 CAGGGCTGGGGGAAGCAGGAAGG + Intronic
1079326258 11:19495023-19495045 CATTGCTGCTTGAAGCAGGCAGG + Intronic
1081121850 11:39276463-39276485 CTGGGCTACCAGAAGCTGGAAGG - Intergenic
1083271517 11:61575216-61575238 CATGGCTGACTGAAGGAGAAAGG - Intronic
1083300014 11:61735335-61735357 CAGGGCTGCCAGAGCCAGCAAGG + Intronic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1084042255 11:66548994-66549016 CAGGGAAGCCTCAGGCAGGAGGG - Intronic
1084965365 11:72741665-72741687 CAGGGCTGACCGCAGCAGGGTGG + Intronic
1087735478 11:101827846-101827868 CAGGGCTGCCTGAAGCTGTAGGG - Intronic
1088545303 11:110952970-110952992 CAGGCCTGCAGGAAGGAGGAGGG + Intergenic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1089286887 11:117413049-117413071 CACGGCTGCCTCAGGCAGGCAGG + Exonic
1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG + Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089744785 11:120609140-120609162 CAGGCCCAACTGAAGCAGGAGGG - Intronic
1091934169 12:4422342-4422364 CAGGGCTGGGTGGAGAAGGATGG + Intergenic
1093396023 12:18683587-18683609 CAGGTCTTCCTGAAGCAGAAGGG - Intronic
1093518087 12:20014989-20015011 CAGGGCTGACTGTGGCTGGAAGG - Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094467680 12:30770994-30771016 CAGGGCATCTTGAAGCAGGGAGG - Intergenic
1095484881 12:42674421-42674443 AAGGGCAGCCAGGAGCAGGATGG - Intergenic
1096181384 12:49552578-49552600 CAGAGCTGCCTGAAGCAGACAGG - Intronic
1096243630 12:49972668-49972690 CAGGACCCCCTGAAGCAGGCCGG + Intronic
1096317577 12:50581991-50582013 CAGGGCTGCCTGAGACAAGGGGG - Intronic
1098199004 12:68035093-68035115 CAAGGCTGCCTTCAGCAGGAAGG + Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098268835 12:68750624-68750646 CAGGACTGCCTGGAACAGCAGGG - Intronic
1098683083 12:73382573-73382595 CAGGGCTGCCTGCAGCTGACAGG - Intergenic
1100510136 12:95262937-95262959 CAGGACTTCCTGTTGCAGGATGG - Exonic
1102062617 12:109945137-109945159 AAGTGCTGCCTCATGCAGGACGG + Intronic
1103716829 12:122949984-122950006 CAGGCCTGCCGGCAGCGGGAGGG - Intronic
1103721194 12:122976439-122976461 TGGGGCAGCCTGAAACAGGATGG + Intronic
1103729053 12:123013875-123013897 CAGGGCTGCCTTGGGCAGGATGG + Exonic
1104083832 12:125457007-125457029 CAGACCTGCCTGCAGCAGGGAGG - Intronic
1104393068 12:128407561-128407583 ATGGGCTGCCTGATGCAGGATGG + Intronic
1104876537 12:132038838-132038860 CAGGGCCACATGAAGGAGGAGGG - Intronic
1105914735 13:24902856-24902878 CATGGCTGCCTGCTGCGGGATGG - Intronic
1105927058 13:25018199-25018221 CAGGGCTCCCTGGAGCCGCAAGG + Intergenic
1106316217 13:28596333-28596355 CTGGGCTGCCCGGAGCAGGGAGG + Intergenic
1106549424 13:30758572-30758594 CAGGGCAGCCTGAAGCCTGAAGG - Intronic
1107070172 13:36259929-36259951 CAGGCCTGCCTGAGGCAGGTGGG + Intronic
1107598876 13:41992283-41992305 CAGGGATGTCTTAAGCAGGGTGG - Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1111192661 13:84830774-84830796 CAGGGCTGTCAGAGGCTGGAGGG + Intergenic
1111971119 13:94917916-94917938 CAGAGCTACCTCATGCAGGATGG + Intergenic
1112250463 13:97774555-97774577 CACGGCAGCCTGAGGCAGGGAGG - Intergenic
1113435711 13:110289454-110289476 CAGGGCTGCCTGGAGCAGTGGGG - Intronic
1113627644 13:111858379-111858401 CAGGGGTGCCGGAAGCACCAAGG - Intergenic
1113649580 13:112026439-112026461 GGGGGCTGCCTGAAGAAGGAGGG + Intergenic
1113931979 13:113973529-113973551 AGGGACAGCCTGAAGCAGGAGGG - Intergenic
1114260751 14:21034466-21034488 CAGGGCTGGCTGAAGGTGGCTGG - Intronic
1114655008 14:24310738-24310760 CAGCGCCGCCAGCAGCAGGAAGG - Exonic
1114735997 14:25044493-25044515 CAGGGGTGCCTGGAACTGGACGG - Intronic
1114751845 14:25213122-25213144 CAGTGCTGCTTGAATGAGGAAGG - Intergenic
1115584560 14:34797843-34797865 CAGGGCGGGCCGAAGCAGGGCGG + Intronic
1118991804 14:70803500-70803522 CAGGGCTGGCTGAGTAAGGAAGG - Intronic
1119347757 14:73940549-73940571 CTGGGCAGCCTGGAGCAGGGGGG - Intronic
1119598345 14:75957123-75957145 CCGGGCTCCCTGGAGCAAGATGG + Intronic
1119663164 14:76465734-76465756 GAGTTCTGCCTGAAGGAGGAAGG + Intronic
1119736280 14:76984806-76984828 CAGGGCTGAGTTAAGCAGGGAGG - Intergenic
1121826731 14:97016349-97016371 GAGGGCTGCCTGAAGCTGGCAGG + Intergenic
1122104446 14:99441612-99441634 CAGGGAAGCCTGCAGCAGGCAGG + Intronic
1122859920 14:104577914-104577936 CAGGCCTGCCTGCAGCCGGCAGG - Intronic
1123020160 14:105394280-105394302 CAGGGCTGCCTGCAGGTGGAAGG - Intronic
1123023535 14:105413045-105413067 GAAGGCTTCCTGAAGGAGGAGGG - Exonic
1123784064 15:23651097-23651119 GAGGGCTTCAGGAAGCAGGAAGG - Intergenic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1125550522 15:40541203-40541225 CAGGGCTGCCTGAAAGTGGCAGG + Intronic
1125612333 15:40980014-40980036 CTGGGGTGCCTGTAGGAGGAAGG - Exonic
1125931792 15:43605288-43605310 CAGGGCTGCCTGGTGGAGGGGGG + Exonic
1125944892 15:43704766-43704788 CAGGGCTGCCTGGTGGAGGGGGG + Intergenic
1126074543 15:44896510-44896532 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1126653696 15:50953480-50953502 CAGAGCAGGATGAAGCAGGATGG - Intronic
1127799212 15:62463067-62463089 AAGGGCTGCCAGAGGCAGGGGGG - Intronic
1128476194 15:67998780-67998802 CAGGGCTGCCAGGAGCTGGCTGG + Intergenic
1128601729 15:69000760-69000782 CAGGGCTGGAGGTAGCAGGAGGG + Intronic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129360965 15:75023830-75023852 TGGGGCCGCCTGGAGCAGGAGGG + Intronic
1129362013 15:75029989-75030011 AAGGGTTGCCTGGAGCAGGGAGG + Intronic
1129390922 15:75220594-75220616 CTGAGGTGCCTGAAGGAGGAAGG + Intergenic
1129393929 15:75234200-75234222 CAGAGCTGAGGGAAGCAGGAGGG + Intergenic
1129832892 15:78682105-78682127 CAGGGCTGCCTTGTGCAGGGAGG + Intronic
1129871327 15:78943838-78943860 GAGGGCTGCCTGGAGAAGGCTGG - Intronic
1130119874 15:81038587-81038609 CAGCACTGACAGAAGCAGGAGGG + Intronic
1130932401 15:88438930-88438952 CAGGGCTCCCAGCAGCTGGAAGG - Intergenic
1132009832 15:98266327-98266349 CTGGGCTGCATGACCCAGGATGG + Intergenic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132671253 16:1103039-1103061 CGGGGCTGCCCGGAGCAGGACGG - Intergenic
1133231362 16:4368403-4368425 CTCGGCTGGCTGAGGCAGGAGGG + Intronic
1133971010 16:10568009-10568031 CTGGGCTTCCTGAGGCAAGACGG - Intronic
1134448686 16:14349822-14349844 CTGGGGTGGCTGAGGCAGGAGGG - Intergenic
1134581810 16:15377535-15377557 CAGGGCTCCCTGAGGCAGCCAGG + Intronic
1135227105 16:20670475-20670497 CATGGCTGCAGGATGCAGGATGG - Intronic
1136244351 16:28965029-28965051 AAGGGCGGCCTCAAGTAGGAGGG - Exonic
1136713787 16:32261036-32261058 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1136754124 16:32668394-32668416 CAGGGATGCCTGCAGCTGCATGG + Intergenic
1136813989 16:33201971-33201993 CAGGGATGCCTGCAGCTGCATGG - Intronic
1136820465 16:33312051-33312073 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1136827028 16:33368590-33368612 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1136832094 16:33467361-33467383 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1137289325 16:47041216-47041238 GAGGGCAGCCTGAGGCTGGAGGG - Intergenic
1137370075 16:47896990-47897012 GAGGGCTGGCGGAAGCAGGGTGG + Intergenic
1138029787 16:53551046-53551068 GAGGGCTGCTTGAAGGAGGCAGG - Intergenic
1138346050 16:56320861-56320883 CATGTCTGCCTGAGGCATGAAGG - Intronic
1139401437 16:66684919-66684941 CAGGGCTCCAGGAAGGAGGAAGG - Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1141087538 16:81107659-81107681 CTGGGCTGCCTGCAGGAAGAGGG - Intergenic
1141134959 16:81459136-81459158 CAGTCCTGCAGGAAGCAGGAAGG - Intronic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141667906 16:85475327-85475349 CAGGGCTGCCTGTACCTGGGTGG + Intergenic
1142201641 16:88763901-88763923 CAGGTGTGCCTGGGGCAGGATGG - Intronic
1142423951 16:89990852-89990874 CATGGCTCCCTGAAACAGAATGG - Intergenic
1202992565 16_KI270728v1_random:24945-24967 CAGGGATGCCTGCAGCTGCATGG - Intergenic
1203056272 16_KI270728v1_random:928726-928748 CAGGGATGCCTGCAGCTGCATGG + Intergenic
1142537031 17:625352-625374 CTTGGGTGGCTGAAGCAGGAGGG + Intronic
1142984567 17:3688147-3688169 CAGTGCTGCCTAAAGAGGGAAGG - Intronic
1143634567 17:8156918-8156940 CGAGGCTCCCTGAAGCTGGAAGG + Intronic
1143736435 17:8914847-8914869 GAGGGCTGCCAGCAGCATGAGGG + Intronic
1143898654 17:10156776-10156798 GAGGGAGGCCTGCAGCAGGAGGG - Intronic
1144814974 17:18027643-18027665 CAAGGCTGCCTGGGGAAGGAAGG - Intronic
1145016012 17:19398628-19398650 CAGGGCTGCCTGATGTGGGTGGG + Intergenic
1146560190 17:33861973-33861995 AGGGGCTGCTTGATGCAGGAGGG - Intronic
1147906776 17:43828400-43828422 CAGGCCGGACTGCAGCAGGACGG + Intronic
1148000201 17:44383400-44383422 GAGGGCAGCCAGAACCAGGATGG - Intronic
1148071845 17:44913225-44913247 AAGGGCTGCCTGGAGGAGGCAGG + Intronic
1148136578 17:45296415-45296437 CTTGGGAGCCTGAAGCAGGAGGG + Intronic
1149502861 17:57167784-57167806 CGTGGCTGCCAGAGGCAGGAGGG - Intergenic
1149548766 17:57524113-57524135 CAGGCTAGCCTGATGCAGGATGG - Intronic
1151802669 17:76387018-76387040 CAGGGCTGCCAGACGCAGGAAGG - Exonic
1151829989 17:76543874-76543896 CATGTCTGCCTGCAGCTGGATGG + Intronic
1151850554 17:76687229-76687251 CAGCACAGCCTGAAGCAGGAGGG - Intronic
1151908167 17:77063039-77063061 CAGGTCTGACCGAAGCAAGATGG - Intergenic
1152299088 17:79485024-79485046 CAGGGCTCCCAGAGCCAGGATGG + Intronic
1152420033 17:80187729-80187751 CAGGGCTGCCACACCCAGGACGG + Intronic
1152457951 17:80426880-80426902 CTGGGCTGCTGGAAGCAGCATGG - Intronic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153522759 18:5967810-5967832 CAGGACTCCCTGGGGCAGGAGGG + Intronic
1153829869 18:8912648-8912670 CCGGGCTGCCAGGAGGAGGAGGG - Intergenic
1153939662 18:9967391-9967413 CAGGGGTACCTGTAACAGGAAGG - Intergenic
1156523042 18:37738022-37738044 CAGGGCTGCATGCAGTAGGTGGG + Intergenic
1157006689 18:43590731-43590753 TCGGGCTGGCTGCAGCAGGAAGG - Intergenic
1157071660 18:44416065-44416087 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1160016107 18:75141853-75141875 CAGGAGAGCCTGCAGCAGGAAGG - Intergenic
1160339383 18:78074669-78074691 CAGGCCGGCCTGAAGCAGGAAGG - Intergenic
1160420385 18:78739999-78740021 CTGGGCTGGCTGCACCAGGAGGG - Intergenic
1160787096 19:905723-905745 CAGGGCTGCCTGAAGCAGGAAGG + Intronic
1161170110 19:2808283-2808305 CCCGGCTGCCTGCGGCAGGATGG + Exonic
1161522013 19:4729978-4730000 CAGAGCTCCCCGGAGCAGGAGGG - Intergenic
1162174883 19:8823401-8823423 GGGGGCTGACTGAGGCAGGATGG - Intronic
1162174942 19:8823596-8823618 AGGGGCTGACTGAGGCAGGAGGG - Intronic
1162458931 19:10802980-10803002 CCGGCCTGCCTCAGGCAGGAAGG - Intronic
1162609709 19:11739352-11739374 CAGGCCACCCTGCAGCAGGAGGG + Intergenic
1162689185 19:12414504-12414526 CAGGCCACCCTGCAGCAGGAGGG + Intronic
1162881621 19:13663975-13663997 CAGGGCAGCCCCATGCAGGATGG - Intergenic
1162973585 19:14195618-14195640 GAGGGCTTCCTGAAGGAGGCGGG - Intronic
1163263698 19:16206031-16206053 AAGGGCTGCCTTGAGCAGGGAGG - Intronic
1163768965 19:19179266-19179288 CCAGGGGGCCTGAAGCAGGAGGG - Intronic
1163834871 19:19567157-19567179 CAGGGCTGCTTCAACCAGGATGG - Intronic
1164500416 19:28814989-28815011 CAGGGCTGCCTGAGGCAGTGGGG - Intergenic
1165162634 19:33826747-33826769 CAGGGGTGCCTGGGGTAGGAGGG + Intergenic
1165947014 19:39449616-39449638 GATGGCTGCCTGGAGGAGGAAGG + Intronic
1166240235 19:41486502-41486524 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1166253060 19:41584702-41584724 CACAGCTGCCTGGAGCAGGGGGG + Intronic
1166357611 19:42236396-42236418 AAGGCCTGACTGAATCAGGAAGG - Intronic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
1166678936 19:44756041-44756063 CAGTGGTGGCTAAAGCAGGATGG + Intronic
1166729830 19:45052777-45052799 CAGGGCATCCTGAAGTGGGAGGG - Exonic
1167422593 19:49412987-49413009 CAGCGCACCCTGAAGAAGGAAGG + Exonic
1168170582 19:54585765-54585787 AAGGGCGAGCTGAAGCAGGATGG - Intronic
925347609 2:3181704-3181726 CCGGGCTGCCTGATGGAGGAAGG - Intergenic
925755581 2:7128459-7128481 GAGTGCTGCCTGGGGCAGGAAGG - Intergenic
926111414 2:10186766-10186788 CACCCCTGCCTGAAGCAGGGTGG + Intronic
926267922 2:11343861-11343883 CCCGGCTGCCGGAAGCAGGGCGG + Intronic
926999259 2:18775294-18775316 CAGGGCAACATGAAGCAGGGTGG - Intergenic
927491073 2:23521280-23521302 CAGCTCTGCCTGCAGGAGGAAGG + Intronic
927685046 2:25164707-25164729 CATGGAGGCCTGAAGCAGCAAGG + Exonic
927692060 2:25215504-25215526 CAGGGCAGACTGAAGCTGCAAGG - Intergenic
927937486 2:27083874-27083896 CAGGGCTGCCTGCATCTGGCTGG - Exonic
928138212 2:28704788-28704810 CTGGGCTGTCAGAAGCATGATGG + Intergenic
928173428 2:29017996-29018018 CAGGGCATCCTGAGGCAGCATGG - Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929871346 2:45761831-45761853 CAGCCCTGGCTCAAGCAGGAAGG - Intronic
932322990 2:70835492-70835514 AAGGACGGCCTGCAGCAGGACGG + Exonic
933763869 2:85694432-85694454 CATGGCTGCAAGGAGCAGGAGGG - Exonic
934687542 2:96332944-96332966 CAGGGCTGCCTTATGCGGGCAGG - Intergenic
935134947 2:100291746-100291768 CTGGGCAGCATGGAGCAGGAGGG - Intronic
936258814 2:110939698-110939720 CAGGGCTGCATGAGGCCTGAGGG - Intronic
936437491 2:112521055-112521077 CAGAGCCTCCTGAGGCAGGAAGG + Intronic
937239280 2:120449989-120450011 GAGGGCTTCCTGAAGGAGGTGGG + Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
938576015 2:132605529-132605551 CAGGCCAGCGAGAAGCAGGAAGG - Intronic
938849400 2:135245192-135245214 TAGGGCTGCCATAAGCTGGAAGG + Intronic
942132470 2:172893814-172893836 CAGAGATGCCTGAGGCAGGATGG - Intronic
943564605 2:189503074-189503096 CAGGTCTCCCTGAAGGAAGAGGG - Intergenic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
945815501 2:214600762-214600784 CAAGGGTTCCTGAGGCAGGAAGG - Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
946107837 2:217387718-217387740 CAAGGCCACCTGGAGCAGGATGG + Intronic
946189743 2:218002058-218002080 GAGGGCTGCCTGCTGCAGAAGGG - Intronic
946311891 2:218886647-218886669 CTGGGCTGCCCGGAGCAGGGAGG - Intronic
948365458 2:237451844-237451866 CAGGGGTGCCGGAAGGAGCATGG - Intergenic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
1169123464 20:3110996-3111018 CAGGGCTGCCAGTAGCAGTGAGG - Intronic
1172219316 20:33262065-33262087 CTGGTCTGAATGAAGCAGGAAGG - Intergenic
1172520117 20:35560689-35560711 AGGGGCTGCAGGAAGCAGGAGGG + Intergenic
1172644516 20:36461489-36461511 CCGGGCTGCGTGAGGGAGGAGGG + Intronic
1172781469 20:37439340-37439362 CAGGGCTGGCTGACGCTGGAGGG - Intergenic
1172987126 20:39000688-39000710 CTGGGTTTCCTGGAGCAGGATGG + Intronic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1173857466 20:46259650-46259672 GAGGGCTGCCTGGAGGAGGGGGG + Intronic
1174172384 20:48625645-48625667 CACGCCTGCCAGAAGCTGGAGGG - Exonic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1174432926 20:50483718-50483740 GAGAGCTGCCTGAAGCTAGATGG - Intergenic
1174478728 20:50815864-50815886 CACGCCTCCCTGGAGCAGGACGG + Intronic
1175084535 20:56447454-56447476 CAGGGCTGCAAGAGGCAGGCAGG + Intronic
1175398980 20:58689104-58689126 CAGGTCATTCTGAAGCAGGAAGG + Intronic
1176036806 20:63043603-63043625 CAAGGCTTCCTGAAGGAAGAAGG + Intergenic
1176423816 21:6535531-6535553 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1178985487 21:37299212-37299234 CAGCGCTCCCTAACGCAGGAAGG + Intergenic
1179699309 21:43143846-43143868 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1179779593 21:43690807-43690829 CAGTGCTTCCTGATGCAGGCTGG + Intronic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1182486438 22:30641903-30641925 TTGGGCTGCCTGATTCAGGAGGG + Intronic
1183332845 22:37230513-37230535 CAGGGCTGCCTGCATCAGGGAGG - Intronic
1183600962 22:38840446-38840468 TGGGGCTGCCTGGAGGAGGATGG + Intronic
1183722852 22:39572402-39572424 CAGGGATGCCAGATGCAGGCTGG + Intronic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1184378394 22:44129563-44129585 CAGGGCAGCTTGGAGAAGGAAGG - Intronic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
1184526758 22:45028600-45028622 CCAGGCTGCCTGAAGCTGAAGGG - Intergenic
1184694743 22:46133124-46133146 CAGGGCTGACTGCCCCAGGACGG - Intergenic
950127049 3:10516229-10516251 CAGGGCAGCCTGCAGCAGGGAGG - Intronic
950541911 3:13617934-13617956 CAAGGATGGATGAAGCAGGATGG - Intronic
950575338 3:13828845-13828867 AAAGGCAGCCTGAAGCAGAAGGG + Intronic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
954799227 3:53177589-53177611 AAGGGCTGCATGGGGCAGGATGG + Intronic
957402995 3:79741154-79741176 TAGGGCTACCTGCTGCAGGATGG + Intronic
958905223 3:99934654-99934676 CAGGGCTGCCTTAAGCTAAAAGG - Intronic
960583627 3:119301255-119301277 CTGGGCCTCCTGAAGCTGGAAGG - Intronic
960936885 3:122909988-122910010 CAGAGCTCTCTGAAGCCGGATGG + Exonic
960953181 3:123012717-123012739 CAGGGCTGCAGGAGGCAAGAAGG + Intronic
961578352 3:127856932-127856954 GAAGGCTGGCTGAGGCAGGAAGG + Intergenic
963246866 3:143071886-143071908 CAGAGCTGGCTGCAGCAGAAAGG + Intergenic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
965331483 3:167380030-167380052 CAGGCCTGCAGGCAGCAGGACGG - Intronic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
966871005 3:184290665-184290687 CAAGTGTGTCTGAAGCAGGAGGG + Exonic
968433755 4:574945-574967 CAGGGCGGCCGGCAGCAGTAGGG + Intergenic
968472270 4:787620-787642 CGGGGCCGCCAGACGCAGGAAGG + Intronic
968521788 4:1037516-1037538 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968521808 4:1037596-1037618 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968814874 4:2817149-2817171 CAGGAGTGGCTGAATCAGGAAGG + Intronic
969056587 4:4406463-4406485 CAGGGCTGCCTCACTCAGGGTGG - Intronic
969161247 4:5260912-5260934 CAGGGTGGTCTGAAGCTGGATGG + Intronic
969400608 4:6953113-6953135 AAGAACTGCCTGAAGCTGGAAGG - Intronic
969421774 4:7101834-7101856 CAGCCCTGCCTCAAGCTGGAGGG - Intergenic
969621246 4:8280019-8280041 CGGGGCTGCCTGGAGGAGGCAGG + Intronic
969937135 4:10693501-10693523 TAGGGCTGCCAGAAGCTGAAAGG + Intergenic
970585671 4:17512051-17512073 CCGGGCTGGCAGGAGCAGGATGG - Exonic
970607301 4:17692667-17692689 CATGGGTTCCTGAAGCAGGTGGG + Intronic
970929946 4:21498019-21498041 CAGGGCTTTCTGAAGGAGTATGG - Intronic
971456536 4:26850456-26850478 GAGGACTGCCTGAACCAAGAGGG + Intergenic
972284743 4:37637472-37637494 CAGGGCTGGCTGTAGGAAGAAGG - Intronic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972649088 4:40998910-40998932 CTGGGCGGGATGAAGCAGGATGG + Intronic
975006040 4:69287538-69287560 GAACACTGCCTGAAGCAGGAAGG + Intronic
976328349 4:83798793-83798815 TAGTGGTGGCTGAAGCAGGAGGG - Intergenic
976980623 4:91222163-91222185 CAGGGCTGAATGAAGAAGCACGG + Intronic
977651350 4:99473169-99473191 CAGGGCTGCCTGAAGCCTTTGGG - Intergenic
977895526 4:102360730-102360752 CAGGACTGCTTGAAGACGGATGG - Intronic
978464498 4:108994126-108994148 GAGGGCTACCTGAAGCAGGGAGG + Intronic
979936370 4:126702025-126702047 CAGAGATGCCTGAAGCAGAAGGG - Intergenic
980339538 4:131526444-131526466 CTGGGCTGCCTGAAGCCTGCGGG + Intergenic
980585584 4:134810605-134810627 TTGGGGAGCCTGAAGCAGGAGGG - Intergenic
980725300 4:136751118-136751140 CAGGGCAGAATGAAGCAAGATGG + Intergenic
982943569 4:161589558-161589580 CTTGGGTGGCTGAAGCAGGAGGG - Intronic
983219164 4:165027915-165027937 CTGGGCAGCATGGAGCAGGATGG + Intergenic
984787979 4:183586883-183586905 CAGCTCTGCCTGAATCAGAAAGG - Intergenic
985640738 5:1062464-1062486 CAGGCCTGCGTGACGCTGGATGG - Intronic
986013666 5:3739335-3739357 CTGTGCAGCCTGAAGCTGGAGGG - Intergenic
986401761 5:7388911-7388933 CAGGGCAGCTGCAAGCAGGAAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987638005 5:20570684-20570706 CAGGGCTGGCTCAAGGATGAAGG + Intronic
988672931 5:33401445-33401467 CAGGGCTAGCTGAACCAGGCAGG + Intergenic
988701215 5:33676941-33676963 TAGGGCTGACAGCAGCAGGAAGG - Intronic
989109569 5:37894249-37894271 CAGGGTTGACTGAATTAGGACGG + Intergenic
990970644 5:61502197-61502219 CAGGGATGCCAGGAGCAGGAAGG + Intronic
991039990 5:62165228-62165250 CTGGGCTGCCTGTAGCAAGATGG - Intergenic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
994085519 5:95754014-95754036 CAGAGCTGCATGAACCAGGGTGG + Intronic
994776268 5:104038715-104038737 CAGGACAACTTGAAGCAGGAAGG - Intergenic
995058501 5:107788657-107788679 CAGGGCTGCCTGGAGCTGCGAGG + Intergenic
995493912 5:112721953-112721975 CAGGGCTGCATGGCCCAGGATGG - Intronic
997220442 5:132157658-132157680 GAGGGCGACCTGAAGCAGGGTGG - Intergenic
997996266 5:138589258-138589280 CAGAGCAGCATGATGCAGGAAGG - Intergenic
998040723 5:138949463-138949485 CAGAGCTGCCTGAAGGTGGAGGG - Intronic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
999717883 5:154376522-154376544 GATGGCTCCCTGCAGCAGGAGGG - Intronic
1000052064 5:157572043-157572065 CAGGGTTGCCTTGAGCATGAAGG - Intronic
1006502181 6:34466106-34466128 CGGGGCTGCGGGAAGGAGGAAGG - Exonic
1006646064 6:35515059-35515081 CAAGGCTGCCTGAGGAAGGAAGG + Intergenic
1006946622 6:37788644-37788666 CATGGCCACCTGAAGCAGGATGG - Intergenic
1007021231 6:38523499-38523521 CAGAGCTCTCTGAAACAGGAGGG - Intronic
1007092457 6:39192703-39192725 GAAGGCTCCCTGCAGCAGGAGGG - Intronic
1007117543 6:39354192-39354214 AAGGGCAGCCTGAGACAGGAGGG - Intronic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007414531 6:41684047-41684069 GGGGGCTGCCAGAAGCGGGAGGG - Exonic
1007509071 6:42361771-42361793 CAGAGCTGCCTGAAGGAGGATGG - Intronic
1008291713 6:49723811-49723833 CAGGGCAACTCGAAGCAGGAGGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1010605921 6:77889771-77889793 CAAGGCTGCATAAAGCAGGGAGG - Intronic
1011907280 6:92387450-92387472 CATGGCAGCCTGAGGCAGGAAGG + Intergenic
1013586161 6:111581006-111581028 CAGGGCTGCTTGAAGAGGGCTGG + Intronic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1014796331 6:125728959-125728981 CAGGGCTGCTGGAAAAAGGAGGG + Intergenic
1015861945 6:137690611-137690633 CAGTGCTGCCTGAGGCATCATGG - Intergenic
1017752714 6:157503244-157503266 GATGGCTGCCAGAAGCAGGTGGG + Intronic
1017962323 6:159233195-159233217 ATGGGCTGCCTGGAGGAGGAAGG - Exonic
1018548349 6:164963062-164963084 CAGGGCTGCCTGAAGCCCTGGGG + Intergenic
1018762722 6:166905557-166905579 CAGGTCTCCCTGAAGAGGGATGG + Intronic
1018787399 6:167118920-167118942 CAGGGCTGCCGCCAGGAGGAGGG + Intergenic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1019792721 7:3027452-3027474 CAGGTCTGCCTGAAGGAGTCAGG - Intronic
1019881399 7:3864639-3864661 CAGGGCTGTCTGAGACTGGACGG - Intronic
1020009897 7:4802060-4802082 CTGGGCAGCCTGCAGCAGAAGGG + Intronic
1021306674 7:19040220-19040242 GAGGGCTAGCTGAAGCAGGGTGG - Intronic
1022047079 7:26630534-26630556 CCGGGCTGCCTGAAGCCAGTGGG + Intergenic
1022108075 7:27210936-27210958 CAGGCCTGACAGAGGCAGGAGGG - Intergenic
1025038532 7:55619118-55619140 CAAGGCTGCATGGAGCAGGGGGG - Intergenic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027987055 7:85306592-85306614 AAGTGCTGCCTGAATCAGGCTGG - Intergenic
1028471200 7:91208395-91208417 GAGGGCTGCCTGATGCAGGCCGG + Exonic
1029215111 7:98942392-98942414 CAGGAATGCCAGAAGCAGAAGGG - Intronic
1029365156 7:100111991-100112013 CAGGGCTTCCTGTGGGAGGAGGG + Exonic
1030166441 7:106560416-106560438 GAGGGCGAGCTGAAGCAGGATGG - Intergenic
1031596497 7:123655894-123655916 CAAGGCGGCCAGAAGCAGGCAGG - Exonic
1032431041 7:131861785-131861807 CAGGGCTACTAGAAGCAGGAAGG - Intergenic
1033153629 7:138937657-138937679 CACAGTGGCCTGAAGCAGGAAGG + Intronic
1033292573 7:140100052-140100074 CAGGGCTACCTGAGGGTGGATGG - Intronic
1033357904 7:140615625-140615647 CAGGATTGCTTGAACCAGGAAGG - Intronic
1035213464 7:157346721-157346743 CAGTGATGACTGAAGCAGTAAGG + Intronic
1035693315 8:1573781-1573803 CAGCCCTGCCTGAAGCTGGGAGG - Intronic
1036615794 8:10386387-10386409 CAGATATACCTGAAGCAGGAGGG + Intronic
1036626818 8:10479298-10479320 CAGGGCGACCCGCAGCAGGAGGG + Intergenic
1036791474 8:11723982-11724004 GGGGGCTGCCTGAGGCTGGAGGG - Intronic
1037804662 8:22052437-22052459 CACGTCTGCCTAAAGAAGGAAGG - Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039058299 8:33553951-33553973 CAGCCCTGCCTTAAGCAGAAAGG - Intronic
1039835718 8:41254821-41254843 CAGGGCTTCCTAAAGCAGTTTGG + Intergenic
1040334781 8:46410516-46410538 CAGGGCTGCCCCAGGCAGGCTGG + Intergenic
1041153503 8:54960523-54960545 CAGGGGTGCCTGAGGCCAGAGGG - Intergenic
1041653955 8:60330252-60330274 CAGCGCTCCATGAAGCAGGTGGG + Intergenic
1041727575 8:61032231-61032253 CAGGGGTGACAGGAGCAGGAAGG + Intergenic
1043544088 8:81295642-81295664 CAGGGCTGCCTGGTGCAGTGTGG + Intergenic
1044006261 8:86940510-86940532 CACAACTGCCTGAAGAAGGAGGG + Intronic
1048116877 8:131533140-131533162 GAGGGCTGCCTGAGGAATGACGG - Intergenic
1048474877 8:134734054-134734076 AACGGCGTCCTGAAGCAGGAGGG - Intergenic
1048632093 8:136255130-136255152 CAGGGATGCCTGAATCAGGCAGG + Intergenic
1048825191 8:138417341-138417363 CAGACCTGCCTAAAGCTGGAGGG + Intronic
1049265598 8:141666294-141666316 CAGGGCTGCCAGCTGCACGAAGG + Intergenic
1049299098 8:141860454-141860476 GAGGGCATCCTGATGCAGGAGGG - Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049389447 8:142360484-142360506 CAGGGCTGCCTCAATGAGGCCGG + Intronic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049579951 8:143406714-143406736 CAGGCCAGCCTGAGGCAGGCAGG - Intergenic
1049680339 8:143915328-143915350 CAGGGCTGGGTGCAACAGGAGGG + Exonic
1050894786 9:10872854-10872876 CTAGGCTGCCTACAGCAGGAGGG + Intergenic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052406196 9:28064336-28064358 CAGGGCTGCTTATAGCAGGTTGG + Intronic
1052816559 9:33106646-33106668 CAGGGCTTCCTGGAGCATCACGG - Intronic
1052980039 9:34441442-34441464 CAGGGCTTAGTGAAGCAGGGTGG + Intronic
1053173761 9:35908223-35908245 CAGGGCTGCAGGGAGCAGGCTGG - Intergenic
1056014026 9:82363316-82363338 CAGGGGTGCCAGAAGAGGGAGGG + Intergenic
1056230462 9:84538303-84538325 CTGAGCTGCCTGGAGCTGGAGGG + Intergenic
1056724936 9:89106502-89106524 CAGGGCAGCCTGGAGGAGCAGGG + Intronic
1059365192 9:113781388-113781410 GAAGGCTTCCTGAAGGAGGAGGG - Intergenic
1059953174 9:119489019-119489041 CAGGACTGTCTGCAGAAGGAAGG - Intergenic
1060340131 9:122767943-122767965 CAGAACTCCCTGGAGCAGGAAGG - Intergenic
1060757958 9:126226419-126226441 AGGAGCTGCCTGAAGCTGGAGGG + Intergenic
1061242241 9:129381509-129381531 CAGGCCTGGCTGCAGCAGGCTGG - Intergenic
1061498614 9:130989914-130989936 CAGGGCTGCCTGGAGGATGGCGG + Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062231925 9:135486652-135486674 CAGGGCTGCGTGCAGGAAGAAGG + Exonic
1062501671 9:136854481-136854503 CAGTGCTTCCTGAAGCCGTATGG - Intronic
1062534088 9:137013984-137014006 CAGGGCAGCCGCAAGCTGGACGG - Exonic
1062703251 9:137919153-137919175 CAGTGCTGCCTGCCCCAGGATGG - Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1186857259 X:13638268-13638290 CAGGCCTGCCTGCAACAGGCTGG + Intergenic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1188007283 X:25024161-25024183 CAGGCCTGCATGAGGAAGGAAGG - Intergenic
1189210892 X:39280999-39281021 GAGGGCTAGCTGAAGCAGCATGG - Intergenic
1189335965 X:40171210-40171232 CGGGGTTGCCTCCAGCAGGAGGG - Intronic
1189372615 X:40441091-40441113 CATGGCTGCTTGAAGCAGGGAGG + Intergenic
1189975403 X:46456821-46456843 CAGGACTTCCTGTTGCAGGATGG + Intronic
1191704135 X:64075740-64075762 CAGGATTGCTTGAACCAGGAAGG + Intergenic
1192631578 X:72781718-72781740 CAGCGCTGCCTCGAGGAGGAGGG + Intronic
1192634877 X:72807278-72807300 CAGCGCTGCCTCGAGGAGGAGGG + Intronic
1192650131 X:72939083-72939105 CAGCGCTGCCTCGAGGAGGAGGG - Intronic
1193359101 X:80560055-80560077 CAGGACTGCGAGAAGCAGGGAGG - Intergenic
1193435992 X:81475426-81475448 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1193686205 X:84580019-84580041 CAGGACTGCATAAAGCAGCAAGG - Intergenic
1194886093 X:99318116-99318138 CAAGACTGCATGAAGCAGTAAGG - Intergenic
1196060737 X:111405240-111405262 CAGGGCTTCCTGACTCAAGAAGG + Intronic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1198618101 X:138480350-138480372 CAGGGCTGACTGAAGGGGCAGGG - Intergenic
1198650625 X:138860232-138860254 CAGGGCTCCCTCAAGTAGGATGG + Intronic
1198680632 X:139178007-139178029 CAGGGCGAGCTGAAGCAGGGTGG - Intronic
1200047758 X:153411647-153411669 CGGGCCTGCCGGGAGCAGGAAGG + Intergenic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic