ID: 1160789690

View in Genome Browser
Species Human (GRCh38)
Location 19:917777-917799
Sequence GGCCCTCGGAGCCCCCGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160789690_1160789706 28 Left 1160789690 19:917777-917799 CCGTCCCGGGGGCTCCGAGGGCC 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1160789706 19:917828-917850 CATCGGGGCCCTCTCGGACCCGG 0: 1
1: 1
2: 0
3: 13
4: 68
1160789690_1160789702 13 Left 1160789690 19:917777-917799 CCGTCCCGGGGGCTCCGAGGGCC 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1160789702 19:917813-917835 CGCCCTCTCGCGACGCATCGGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1160789690_1160789696 -10 Left 1160789690 19:917777-917799 CCGTCCCGGGGGCTCCGAGGGCC 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1160789696 19:917790-917812 TCCGAGGGCCGAGCGGCCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1160789690_1160789701 12 Left 1160789690 19:917777-917799 CCGTCCCGGGGGCTCCGAGGGCC 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1160789701 19:917812-917834 GCGCCCTCTCGCGACGCATCGGG 0: 1
1: 0
2: 0
3: 0
4: 14
1160789690_1160789700 11 Left 1160789690 19:917777-917799 CCGTCCCGGGGGCTCCGAGGGCC 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1160789700 19:917811-917833 GGCGCCCTCTCGCGACGCATCGG 0: 1
1: 0
2: 0
3: 2
4: 24
1160789690_1160789705 22 Left 1160789690 19:917777-917799 CCGTCCCGGGGGCTCCGAGGGCC 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1160789705 19:917822-917844 GCGACGCATCGGGGCCCTCTCGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160789690 Original CRISPR GGCCCTCGGAGCCCCCGGGA CGG (reversed) Intronic
900166669 1:1246756-1246778 GGCGCTCAGAGCCCCCGCGCGGG + Intergenic
900187574 1:1339553-1339575 GGCCCTCGGGGCACACGGGGCGG - Intronic
900241877 1:1621174-1621196 TGCCCTCAGAGGCCCCGCGAGGG + Intronic
900270929 1:1788276-1788298 GGCCTTCGGATCCCCCTGGGAGG - Intronic
900408945 1:2504261-2504283 TGCCCACGGAGCCCCTGGGAGGG + Exonic
900466810 1:2829786-2829808 CACCCTCAGAGACCCCGGGAGGG - Intergenic
900481814 1:2902996-2903018 GGCCACCGGAGGCCCAGGGAGGG - Intergenic
900527369 1:3135816-3135838 GGCCCAGGGAGCCACGGGGAAGG - Intronic
900564170 1:3324238-3324260 GGCACTAGGAGCCCCAAGGAGGG + Intronic
901473480 1:9473432-9473454 GGCCCCTGGATACCCCGGGATGG + Intergenic
902334615 1:15747756-15747778 GGCCCTGGGAGCCCCGAGAAGGG + Exonic
902520323 1:17011975-17011997 GGCCCTCGCAGCGCCCGCGCCGG + Intergenic
902624454 1:17668475-17668497 GGCCATTGGGGCCCCAGGGATGG - Intronic
902869264 1:19303822-19303844 GGCCCGAGGAGACCCTGGGAGGG + Intergenic
903261002 1:22131897-22131919 GGAGCTCGGAGCCCCTTGGAGGG + Intronic
904190204 1:28737335-28737357 GGGCCTCGGAGCCCACGGGCCGG + Intronic
904822672 1:33256012-33256034 GGCCCCGGGAGCCCCCGCGCTGG + Intergenic
905617255 1:39409436-39409458 GGCCCTCGGGGCGCGCGGCATGG + Intronic
914753140 1:150549295-150549317 GCCCCTCGGCGGCCCCGGGGTGG - Intergenic
914916578 1:151822802-151822824 GAGCCTCAGAGCCCCAGGGAAGG + Intronic
917959219 1:180129044-180129066 AGCCCTCGGAGCCAAGGGGAAGG - Intergenic
919826546 1:201507252-201507274 TGCCCTCCTAGGCCCCGGGAAGG + Exonic
919834768 1:201566078-201566100 GGCCCCTGGAGCCCACAGGAAGG - Intergenic
920509145 1:206537994-206538016 TGCTCTCGGATCCCCCAGGAAGG - Intronic
1063004146 10:1952531-1952553 GGCTCTGGGAGTCCCAGGGAGGG - Intergenic
1064404289 10:15047354-15047376 GGGTATCGGAGCCCCTGGGATGG - Intronic
1065727104 10:28677343-28677365 GCCGCTCGGAGCCGCCGGGCAGG + Exonic
1065732573 10:28722682-28722704 GGCTCTAGGAGCCGCAGGGATGG + Intergenic
1067337056 10:45374500-45374522 GGCCCTCGGCGCCCCCGCCCAGG - Intronic
1067469156 10:46523621-46523643 GGCTCTAGGAGGCCCTGGGAAGG + Intergenic
1070247580 10:74746814-74746836 GGCTCTCTGAGCCCCTAGGATGG + Intergenic
1070780370 10:79134131-79134153 GGCCCTCGAACCCCCCAGGTGGG - Intronic
1075144452 10:119872136-119872158 GGCCCGCAGAGCCGCGGGGAGGG - Intronic
1075439437 10:122467685-122467707 AGGCCTTGGAGCCCCAGGGAAGG - Intronic
1076516973 10:131051413-131051435 AGTCCTCGGAGCCCCTGGGAGGG - Intergenic
1076539595 10:131205837-131205859 GGCTGTGGGAGCCCCTGGGATGG + Intronic
1076590316 10:131578104-131578126 GGCGCTGGGAGCCCCAGGGTGGG - Intergenic
1076707211 10:132308347-132308369 GGCCCCCGGAGACCGCGAGAAGG - Intronic
1076732287 10:132444835-132444857 GGACCTTGGAGCCCCAGGGTGGG - Intronic
1076919859 10:133445929-133445951 GGCCTTTGGAGCCCCGGGGTCGG - Intergenic
1077118971 11:898106-898128 GGTCCTCTGAGCCCCTGGGCAGG + Intronic
1077553789 11:3216163-3216185 GTCCCTCTGAGCCCCCCAGATGG + Intergenic
1078132009 11:8620938-8620960 GGCCCACAGAGCTCCCAGGATGG - Intronic
1079166252 11:18046204-18046226 GGTCCCCGGTGCCCGCGGGAAGG + Intergenic
1080628508 11:34052141-34052163 GAGCCTCGGAGCCCCCGGGCTGG + Intronic
1080925443 11:36751474-36751496 GTCCCTAGGAGTCCCCAGGAAGG + Intergenic
1081613976 11:44579612-44579634 GGCCCAGGGAGCCCTGGGGAGGG + Intronic
1081635323 11:44717685-44717707 GGCCCACAGAGCCCCAGAGATGG - Intergenic
1083327514 11:61880307-61880329 GGCCCTGGGAGGACCAGGGAGGG - Intronic
1084784964 11:71437016-71437038 GGTCCTTGGAGCCCCCCGCATGG - Intronic
1091807735 12:3367729-3367751 GCCCTTCGGAGTCCCCGTGAAGG - Intergenic
1096069295 12:48766098-48766120 GGCCCACGGAGCCCTGGGGCAGG + Intergenic
1103613716 12:122139282-122139304 GGTCCTCGAAGCCACAGGGAGGG + Intronic
1106804302 13:33290356-33290378 GGCCTTCAGAGCCCACAGGAAGG - Intronic
1112504538 13:99968329-99968351 GGCCCACGCGGCCGCCGGGAGGG + Intronic
1113145500 13:107203482-107203504 GGCCCTCTGAACCCTCTGGAAGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114483221 14:23047967-23047989 GGCCCCCTGAGCGCCCGGGCTGG - Exonic
1120789242 14:88563534-88563556 GCACCTCGGATCCCCCGGGCGGG - Intronic
1122286121 14:100653918-100653940 GGCTCTGGGAGCCCCCGTGGAGG + Intergenic
1122582351 14:102778223-102778245 GGCCCTCGGCGGCCGCGCGAGGG - Intronic
1122694117 14:103544558-103544580 GGCCCTCCCAGCCCCTGGCAGGG + Intergenic
1122780988 14:104143524-104143546 AGCCCTCTTAGCCCCCTGGATGG + Intronic
1122855555 14:104558433-104558455 GGCCTTCGGAGACTCAGGGATGG + Intronic
1123500491 15:20877547-20877569 GTGCCTCAGAGCACCCGGGAGGG + Intergenic
1123557736 15:21451240-21451262 GTGCCTCAGAGCACCCGGGAGGG + Intergenic
1123593963 15:21888521-21888543 GTGCCTCAGAGCACCCGGGAGGG + Intergenic
1124179089 15:27456464-27456486 GGCACTGGGCCCCCCCGGGAAGG + Intronic
1126477383 15:49079770-49079792 GTCCCTCTGAGCCCCTGGCAGGG - Intergenic
1129589770 15:76905065-76905087 CGGCCTCGGAGGCCTCGGGACGG - Intronic
1129956283 15:79639752-79639774 GGCCCTGGGAGCCCTAAGGAGGG + Intergenic
1131110586 15:89762063-89762085 GGCCCTGGGAGCACACAGGATGG + Intronic
1131344216 15:91631120-91631142 GGCCCTGGGAGGCCCAGGGAAGG - Intergenic
1202966088 15_KI270727v1_random:178412-178434 GTGCCTCAGAGCACCCGGGAGGG + Intergenic
1132648455 16:1009845-1009867 GGCGCTCGGAGTCCCCAGGAAGG + Intergenic
1132884898 16:2178365-2178387 AGCCCTTGGAGCCCCCGGCCAGG + Exonic
1133473986 16:6101943-6101965 GGCTCTCGGAGGCCCAGGGTGGG + Intronic
1134565389 16:15247311-15247333 AGCCCTCTGAGCCCCGGGGGTGG - Intergenic
1134737107 16:16509387-16509409 AGCCCTCTGAGCCCCGGGGGTGG + Intergenic
1134930415 16:18202777-18202799 AGCCCTCTGAGCCCCAGGGGTGG - Intergenic
1138327920 16:56191184-56191206 GGCCCGCGGCTCCCCCGGGGTGG - Intergenic
1138443757 16:57050444-57050466 GGCCCTTGGAGGCCCCGGAGAGG + Intronic
1138497162 16:57415699-57415721 GGCCCCCAGAGTCCCTGGGACGG - Intronic
1142278582 16:89136168-89136190 GGCTCCCGGAGCCGCTGGGAGGG + Intronic
1142343181 16:89537275-89537297 GGACCCCAGAGCCCCCGGGAAGG + Intronic
1142611564 17:1111393-1111415 GGCCCTCGGTGCCCCCCTGGAGG + Intronic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1142666057 17:1464491-1464513 GGCCCTGGGAGCCACCAGGTGGG - Exonic
1143321376 17:6070887-6070909 GGCGCTCGGCGCGGCCGGGATGG + Intronic
1144834160 17:18148257-18148279 GGCCCAGTGAGCCCCGGGGATGG + Intronic
1146208260 17:30922596-30922618 GGCCCTCGGCGTCCCCGAGGTGG - Intronic
1147285764 17:39401704-39401726 GGGCCTCGGAGCGCCCGGGAGGG + Intronic
1148081248 17:44968518-44968540 GGGCCGCGGAGACCCCGGGCGGG + Intergenic
1148351700 17:46946014-46946036 GGCCCTGGGAGACCCTTGGAAGG + Intronic
1148615140 17:48996109-48996131 GGCTCCCGGAGCCCGAGGGAAGG - Intergenic
1149995327 17:61403284-61403306 GCCCCTCGAAGCCCCCTGCACGG + Intronic
1151250238 17:72828676-72828698 GGCCATGGGTGCCCCCGGGGAGG + Intronic
1151615176 17:75205427-75205449 GGCCCCCGGAGACGGCGGGAGGG - Intergenic
1152036723 17:77877974-77877996 TGCCCTCAGAGCCCCAGGCAGGG - Intergenic
1152103096 17:78314230-78314252 GGCCCTGGGCGCCCTCAGGACGG - Intergenic
1152573312 17:81129808-81129830 GGCCCTCGGACCTTCCCGGATGG - Intronic
1152584632 17:81183498-81183520 GCCCCTGGGTGCCCCCGGCAGGG + Intergenic
1152593070 17:81223062-81223084 GGCCCAATGAGCTCCCGGGACGG - Intergenic
1152644603 17:81463006-81463028 CCCCCTCGGGGCCCCAGGGAGGG + Intronic
1152662807 17:81550842-81550864 AGCCCCCGGAGCCCCCGAGGAGG + Exonic
1154389608 18:13924959-13924981 GGGCCTCGGAAGCCCCTGGAGGG - Intergenic
1155021564 18:21901456-21901478 GGGCCTCGGAGCTGCTGGGAAGG - Intergenic
1160242399 18:77132912-77132934 GGTCCTCCGAGCTCCCGGGGCGG - Intronic
1160453001 18:78978630-78978652 GGCCTGCGGAGCGCCCGGGCTGG + Intergenic
1160540216 18:79617122-79617144 GGCCCCCGGATCCCCCGGAGAGG + Intergenic
1160731759 19:644490-644512 GTTCCTCCGATCCCCCGGGAAGG + Intergenic
1160731775 19:644533-644555 GTTCCTCGGATCCCCCGGGAAGG + Intergenic
1160731788 19:644576-644598 GCTCCTCAGATCCCCCGGGAAGG + Intergenic
1160748540 19:722885-722907 GCCCCTGGGAGGCACCGGGAAGG + Intronic
1160782889 19:885623-885645 CTCCCCTGGAGCCCCCGGGAGGG + Intronic
1160789690 19:917777-917799 GGCCCTCGGAGCCCCCGGGACGG - Intronic
1160840250 19:1143571-1143593 TTCCCCTGGAGCCCCCGGGAGGG - Intronic
1160873003 19:1285656-1285678 GCCCCTCGGAGACCCCAGGCCGG + Intergenic
1161027358 19:2042731-2042753 GGCCCTAGGAGACTCCGGGCGGG + Intronic
1161196089 19:2987484-2987506 GCCCCTCGGGTCCCCCGGGGGGG + Intronic
1161237274 19:3204313-3204335 GCCCCTCAGAGCCCCGGGGTTGG - Intronic
1161495638 19:4584423-4584445 GGCCTTCAGGGTCCCCGGGATGG + Intergenic
1162798439 19:13098336-13098358 GGCGCACGGATCTCCCGGGAGGG - Intronic
1163160477 19:15461274-15461296 GGTCCTCGAAGGCCCCGGGTGGG - Exonic
1163681158 19:18683482-18683504 CGCGCTCGGGGCCCGCGGGAAGG - Intergenic
1163688132 19:18723912-18723934 TGCGCTTGGAGCCTCCGGGAGGG + Intronic
1165812152 19:38618082-38618104 GGCTCTCAGAGCCCAGGGGACGG - Intronic
1167070985 19:47221813-47221835 GGGCCACAGAGCCCCCGAGATGG - Exonic
1167547077 19:50133810-50133832 GGCCCTCGGACCCTCAGGGTAGG - Intergenic
1167547734 19:50139183-50139205 GGCCCTCGGACCCTCAGGGTAGG - Intergenic
1168078192 19:53991809-53991831 GGCCCTGGGAGCCCGGGGGAGGG + Intergenic
926050144 2:9739594-9739616 GATCCTCTGAGCCCCCGGAAGGG + Intergenic
928186573 2:29115737-29115759 GGCCCTGGGGGCCCGCGGGGAGG + Intronic
928303560 2:30147433-30147455 GGCCCACGGCGCCCCCTGGGCGG + Intronic
929539608 2:42810039-42810061 TGCCCGCGGGGCCCCCCGGAAGG - Intergenic
933760452 2:85668550-85668572 GGGCCTGGGAGGCCCAGGGAGGG - Intronic
934771875 2:96912494-96912516 GGCCCTGGGAAGCCCAGGGAAGG + Intronic
937248062 2:120506230-120506252 TGCCCTGGGAGCCTGCGGGAAGG - Intergenic
938169962 2:129066816-129066838 GGCCCTGGGAGCCTCCGTGGTGG + Intergenic
941383297 2:164822381-164822403 GGCCCTGGGAGCCCCAGGCAGGG + Intronic
941580759 2:167293354-167293376 CGCCCGCGACGCCCCCGGGACGG + Intergenic
944661606 2:201926199-201926221 GGCCCTTGGACCCACAGGGAGGG + Intergenic
947915318 2:233828758-233828780 GGCCCTGGGCGCCCCCAAGAAGG + Exonic
948699071 2:239749285-239749307 GGCCCTCTCAGCTCCAGGGATGG - Intergenic
948910242 2:240999065-240999087 GGCTCGCGGGGCGCCCGGGAGGG + Intronic
948958869 2:241316163-241316185 GGCACTAGGACCGCCCGGGACGG - Intronic
1169220565 20:3820158-3820180 GGCCTTAGGAGGCTCCGGGACGG - Intergenic
1170150292 20:13221065-13221087 CGCACTCGGAGTCCCGGGGAGGG - Intergenic
1170785252 20:19462169-19462191 TCCCCTCAGAGCCCCCTGGAGGG + Intronic
1170998671 20:21391725-21391747 GGCTCGCGGGGCTCCCGGGAGGG - Intergenic
1174811921 20:53653361-53653383 AGCCCTCTGGGCCCACGGGAGGG + Intergenic
1175292126 20:57882794-57882816 AGCCCTGTGAGCCCCCAGGAGGG - Intergenic
1175319493 20:58075171-58075193 GGCCCTGGGCACCCCCGGGCTGG - Intergenic
1175821689 20:61913490-61913512 GGCCCACGGAGCCCCTTGGCAGG + Intronic
1175925128 20:62467662-62467684 GGCCCTGGCTGCCGCCGGGAGGG - Intronic
1175957498 20:62618811-62618833 TCCCCTCAGAGCCCCGGGGAGGG - Intergenic
1176062384 20:63178168-63178190 GCCCCTCGGAGCCCCGCGGGAGG + Intergenic
1178661368 21:34510343-34510365 GGCCTTCGGAGCCCCGGTGAGGG - Intergenic
1179519119 21:41930854-41930876 GGACCTCAGACCCCCAGGGAAGG + Intronic
1179896448 21:44366196-44366218 GGCCCACTGAGTCCCCAGGACGG + Intronic
1180085713 21:45507137-45507159 GGCCCTCCCAGCCCACAGGAGGG - Intronic
1180085739 21:45507202-45507224 GGCCCTCCCAGCCCACAGGAGGG - Intronic
1180085826 21:45507443-45507465 GGCCCTCCCAGCCCACAGGAGGG - Intronic
1180957040 22:19745845-19745867 GGCTCTGGGAGCTCCCAGGAGGG - Intergenic
1181169528 22:21000419-21000441 GGCCCTCGGAGCAGCTGGTAAGG + Exonic
1181519687 22:23438092-23438114 GGCACCCGCAGCCCCTGGGATGG - Intergenic
1181811164 22:25404813-25404835 GGTCCTCGGAGCACGCGGGCCGG + Intronic
1182469992 22:30542568-30542590 GGCCCATGGAGCCCGCGGGCCGG + Intronic
1183504636 22:38202369-38202391 CGTCCTCGGCGTCCCCGGGACGG - Intronic
1184647930 22:45906208-45906230 GCCCCACGGAGCTCCCAGGAGGG + Intergenic
1185100665 22:48839283-48839305 GGCCAGCGGAGGGCCCGGGAGGG - Intronic
1185225178 22:49648053-49648075 GGCCCCCACAGCCCCTGGGAGGG + Intronic
1185343060 22:50300079-50300101 GGGCGCCGGAGTCCCCGGGAGGG - Intronic
950043334 3:9933863-9933885 GGCCCACGGCGCCCGCGGGCTGG + Exonic
950104706 3:10380679-10380701 GCCCCTCTGAGCCCAGGGGAGGG + Intronic
954409797 3:50365471-50365493 GGCCCTCGCAGACCCCGCGGAGG - Exonic
954441278 3:50523557-50523579 GGCCCTTGGAGCCCCCAGCTGGG + Intergenic
955393045 3:58535146-58535168 GACCCTCGGAGCAGCCGGGTTGG - Exonic
961202436 3:125055667-125055689 GGCCCGCGGCGCTCCCGGGGCGG + Exonic
961551619 3:127673086-127673108 GGACCTCGCAGTCCCGGGGAGGG + Intronic
964282332 3:155080058-155080080 GGCGCTGGGAGCCCGTGGGACGG + Intronic
966086152 3:176068916-176068938 GGCCCTGGGAGCACCCTGGTGGG + Intergenic
968651214 4:1760987-1761009 GGCTCCGGGAGGCCCCGGGAGGG + Intergenic
972418954 4:38868455-38868477 TCCACTCGCAGCCCCCGGGATGG + Exonic
976123159 4:81805047-81805069 GGGCCTGGGAGTCCCGGGGATGG - Intronic
976811890 4:89107643-89107665 GGCCATCGTAGCCCCCTGGAGGG + Intronic
977575156 4:98666727-98666749 GGCCATCGGAGCTCCCTGGGGGG - Intergenic
981920364 4:150079009-150079031 CGCCCTCGGAGCAGCCGCGATGG + Exonic
982409309 4:155056373-155056395 GTCCCTCAGAGCCCACAGGATGG - Intergenic
985598316 5:809514-809536 GGCCATCGGAGAACCCGGAAGGG + Intronic
985651360 5:1109214-1109236 AGGCCTCGGAGACCCTGGGAGGG - Intronic
985748156 5:1659515-1659537 TGCACTCAGAGCCCACGGGAAGG - Intergenic
985797209 5:1972141-1972163 GGCCCCCGGAGCCCCCGAGCAGG - Intergenic
995988453 5:118208224-118208246 TGCACTCGGAGCCCCCGGCCAGG - Intergenic
997265166 5:132490976-132490998 GGCCCGCGGTGGCCCCGGGGCGG - Intergenic
999318895 5:150601238-150601260 GGGCCTCGGGGTCCCTGGGATGG + Intronic
1000014605 5:157266202-157266224 GGCCCTCGCAGGCCTCGGGCCGG + Intronic
1001482135 5:172095779-172095801 GGCACAGGGAGCCACCGGGATGG + Intronic
1007327463 6:41073232-41073254 GGCGCTCGCAGGCCCCGGGCCGG - Intronic
1007414664 6:41684545-41684567 GGCCCTCCCAGCCCCCAGGCCGG + Exonic
1008411312 6:51183261-51183283 GGTCCTCAGATCCGCCGGGAGGG - Intergenic
1012401116 6:98843541-98843563 AGCCCTCCGAGGCCCCTGGAAGG + Intergenic
1014724859 6:124962284-124962306 GGCCCTCGGCGCCCCCGAGGCGG + Intergenic
1016217182 6:141618297-141618319 GGCACTCGGAGCAGCCGGCAGGG + Intergenic
1018802769 6:167236362-167236384 TGCCCTGGGGGCCGCCGGGATGG - Intergenic
1019285850 7:222545-222567 GGGTCTCAGAGCCCCCAGGAGGG - Intronic
1019331409 7:462518-462540 GGCCTAGGGAGCCCCCGGCAGGG + Intergenic
1019354023 7:569711-569733 GGCACTCGCAGCCCAGGGGAGGG + Intronic
1019523515 7:1470800-1470822 GGCCCTGGCAGCCCTCGGGGAGG - Intronic
1019591575 7:1838181-1838203 GGCACCCGCAGCCCCTGGGATGG + Intronic
1019640997 7:2103586-2103608 AGCCCTGGGAGCCCCTGCGAAGG + Intronic
1020124588 7:5526449-5526471 GGCCCTCAGAGGCCACGGGATGG + Intergenic
1021717022 7:23469854-23469876 GGCCCGCGGAGCCACCCGGTGGG + Intronic
1024556386 7:50606442-50606464 GGGCCTCGGGGCTCCCGGGCCGG - Intronic
1027249512 7:76390211-76390233 GGCCCTCGCAGCCCCTGGCGAGG - Exonic
1030098549 7:105923528-105923550 GGGCCTCGGAGAACCTGGGAAGG - Intronic
1031927426 7:127651873-127651895 GGCCATGGGAGCCCCAGGGGCGG - Intergenic
1034129488 7:148701673-148701695 GGCCCTCAGAGACCAAGGGATGG - Intronic
1034222963 7:149460070-149460092 CGGCCTCGGGGCCCCGGGGACGG - Intronic
1034458764 7:151186677-151186699 GGGCCTCAGATCCCCAGGGAAGG + Intronic
1034493608 7:151407486-151407508 GGCCCCGGGAGCCCCTGGGCTGG - Intronic
1034888896 7:154822082-154822104 TGCCCTCAGAGCCCCAGGGAAGG - Intronic
1034956556 7:155338829-155338851 GGCCCTCAGAGCCCCCCCAAGGG + Intergenic
1035238578 7:157515905-157515927 GGCCCTCGGGGCCCCTGGAGTGG + Intergenic
1039907604 8:41798093-41798115 GGCCCTGGGTGCCCCTGGGTTGG + Intronic
1040288580 8:46112796-46112818 GGCCCTGGGGGCCTCTGGGATGG + Intergenic
1042994384 8:74679395-74679417 GGCACTCGTAGCCACCTGGATGG - Intronic
1049229943 8:141476788-141476810 GGCCCCGGGAGCCACGGGGAAGG - Intergenic
1049273502 8:141708277-141708299 GGCCCTGGGAGCTCCAGGGACGG + Intergenic
1049583942 8:143424436-143424458 GGTCCTTGGAGCCACCGTGAGGG - Intronic
1051893287 9:21965097-21965119 CGACCTCGGAGCCCGCGGGACGG - Intronic
1057290501 9:93803086-93803108 GGCCCTCCCAGCCCCAGGCATGG - Intergenic
1061089946 9:128420831-128420853 GGCCCCCGGAGCTCTCGGGCCGG - Exonic
1061449435 9:130660461-130660483 GGCGCGCGGAGCTCCCGGGAGGG + Intergenic
1061574445 9:131497250-131497272 GGCCTGCGCAGCCTCCGGGAGGG + Exonic
1061904693 9:133690673-133690695 GGCCCTGGGGGACCCAGGGAGGG - Intronic
1062039745 9:134398797-134398819 GGCCCTAGGCACCCCTGGGAAGG - Intronic
1062125146 9:134856197-134856219 GGGCCTGGGAGCCCCCGGAAAGG + Intergenic
1062406643 9:136399922-136399944 GGCCCTGGGAGCCCCTCGGCTGG - Intergenic
1062459631 9:136657493-136657515 GGTCTTCGGAGCCCTGGGGAGGG - Intergenic
1062540787 9:137040836-137040858 CGCCCCTGGAGCCCCGGGGAGGG - Exonic
1185449769 X:275936-275958 GTCTCCCGGAGCCCCCAGGACGG - Intergenic
1185455433 X:308014-308036 GCCCCTCGGACACCCCAGGACGG + Intronic
1186396095 X:9210725-9210747 AGCCCTGGGAGCCCAGGGGAAGG - Intergenic
1188443121 X:30232007-30232029 AGCCCTCGGAGACCCCGAGCGGG + Intronic
1189247225 X:39572517-39572539 GGCCCTGGGAGCCTCAGTGAAGG + Intergenic
1189821474 X:44873345-44873367 GGGCTGCGGAGCCCCCGGGTCGG - Intronic
1194205135 X:91002924-91002946 CGCCCTCAGAGGCCCCAGGAAGG - Intergenic
1198618365 X:138481729-138481751 GGCCCTGGTAGCCCCCAGGGAGG + Intergenic
1200058851 X:153475102-153475124 GGTCCTCGAAGCCCACCGGAGGG + Intronic
1200141927 X:153906789-153906811 GGTCCTGGGAGCCACTGGGAGGG + Exonic
1200550954 Y:4578045-4578067 CGCCCTCAGAGGCCCCAGGAAGG - Intergenic