ID: 1160789773

View in Genome Browser
Species Human (GRCh38)
Location 19:918043-918065
Sequence TCAGCTGAACAAAGGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160789767_1160789773 -9 Left 1160789767 19:918029-918051 CCAACGGCTCGGTGTCAGCTGAA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG 0: 1
1: 1
2: 1
3: 18
4: 247
1160789763_1160789773 7 Left 1160789763 19:918013-918035 CCCGGTGCAGCGCGGGCCAACGG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG 0: 1
1: 1
2: 1
3: 18
4: 247
1160789762_1160789773 8 Left 1160789762 19:918012-918034 CCCCGGTGCAGCGCGGGCCAACG 0: 1
1: 0
2: 3
3: 4
4: 45
Right 1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG 0: 1
1: 1
2: 1
3: 18
4: 247
1160789765_1160789773 6 Left 1160789765 19:918014-918036 CCGGTGCAGCGCGGGCCAACGGC No data
Right 1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG 0: 1
1: 1
2: 1
3: 18
4: 247
1160789759_1160789773 24 Left 1160789759 19:917996-918018 CCACTCGCGGGGCTCGCCCCGGT 0: 1
1: 0
2: 3
3: 1
4: 67
Right 1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG 0: 1
1: 1
2: 1
3: 18
4: 247
1160789757_1160789773 29 Left 1160789757 19:917991-918013 CCTGGCCACTCGCGGGGCTCGCC 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG 0: 1
1: 1
2: 1
3: 18
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160789773 Original CRISPR TCAGCTGAACAAAGGGCTGG GGG Intronic
900352678 1:2243374-2243396 ACAGCTGCAGAAAGGGCAGGCGG - Intronic
901051366 1:6427377-6427399 TCTGCTGAGAAAGGGGCTGGAGG - Intronic
901799905 1:11701985-11702007 TCAGCTGGAGGAGGGGCTGGGGG - Intronic
903445400 1:23419367-23419389 ACAGCAGAACCAAAGGCTGGAGG - Intronic
903930209 1:26857511-26857533 TCAGCTGAGCCCAGGGCTGGGGG + Exonic
904184510 1:28692962-28692984 CCAGATGAACAAAGTGCTTGGGG - Exonic
905242313 1:36588963-36588985 TCAGCTGGACACAGGGCAAGGGG + Intergenic
905384263 1:37589829-37589851 TCAGCTGAAGGAAGGGGTGCTGG - Intronic
905581626 1:39086784-39086806 TCAACTGAGCAAAGGGATGGTGG + Intronic
906533007 1:46534131-46534153 TCATCTGAATAAGGGGGTGGGGG - Intergenic
907952727 1:59199151-59199173 TCAGGTATACAAAGGGCTGAAGG - Intergenic
912490548 1:110060475-110060497 TCACCTGAACTCTGGGCTGGAGG - Exonic
914714520 1:150243225-150243247 GCAGCTTGACAAAAGGCTGGAGG - Intergenic
914962906 1:152222169-152222191 TTATATGAACAAAGGGCTAGAGG + Intronic
917569253 1:176247304-176247326 TCATTTGGACAAAGGGCTTGAGG - Intergenic
917901179 1:179544948-179544970 CCATCTGAACAATGGCCTGGTGG - Intronic
922815615 1:228446738-228446760 ATAGCTTAACAAAGGGCGGGAGG - Intergenic
923346122 1:233054322-233054344 TCAGGTGAACAAAGGCATTGAGG + Exonic
924397425 1:243637116-243637138 TAAGCTGAATAAAGGTATGGGGG + Intronic
924784719 1:247184377-247184399 CCTGCTGAAGAAGGGGCTGGCGG - Intergenic
1062994375 10:1852130-1852152 GCAGCTGAACATGGGGCTGCAGG + Intergenic
1064248745 10:13690683-13690705 GCAGCTGCAGAAAGGGCTGAGGG + Intronic
1065576739 10:27128481-27128503 TCAGCCTCACAAAGTGCTGGGGG - Intronic
1069823106 10:71239645-71239667 ACTGCTGAACAGAGGACTGGGGG - Intronic
1069841722 10:71343975-71343997 TCAGCTGTACTAAGTGCTAGAGG - Intronic
1070315090 10:75302688-75302710 TCAGCTAAGCAAAGGACTGATGG - Intergenic
1070682694 10:78459943-78459965 AGAGCTGAACACTGGGCTGGTGG - Intergenic
1070689839 10:78516412-78516434 CCAGCTGCACACAGGGCAGGAGG - Intergenic
1073690517 10:105803403-105803425 TCAGGTGAACAAAGAGCATGGGG - Intergenic
1073795923 10:106988332-106988354 TCAGCTGATAAGAAGGCTGGTGG + Intronic
1075831908 10:125419186-125419208 TCAGCAGAAGAAATGACTGGTGG + Intergenic
1075910125 10:126117381-126117403 TCAGCAGATCCAGGGGCTGGTGG + Intronic
1076008606 10:126968314-126968336 TAAAATGAACAAAGGGCTAGGGG + Intronic
1077686580 11:4297893-4297915 TGAACTTATCAAAGGGCTGGAGG + Intergenic
1077691733 11:4349083-4349105 TGAACTTATCAAAGGGCTGGAGG + Intergenic
1077832577 11:5890541-5890563 CCACATAAACAAAGGGCTGGAGG + Intronic
1078438061 11:11341789-11341811 TCAGCTGAAGAAGGAGTTGGGGG - Intronic
1078520413 11:12058482-12058504 TCATGTGAAGAAAGGGCAGGAGG - Intergenic
1078608953 11:12802797-12802819 CCAGGAGAACAAAGGGCTCGGGG - Intronic
1083669228 11:64291265-64291287 TCCGCGGGACAAAGGGGTGGGGG - Intergenic
1084440115 11:69167966-69167988 TCCCCTGAACCAGGGGCTGGGGG - Intergenic
1084682578 11:70675429-70675451 GCACCAGAACACAGGGCTGGAGG + Intronic
1086792052 11:91053031-91053053 TCACTTAACCAAAGGGCTGGGGG - Intergenic
1086998825 11:93392052-93392074 TCAGATGAAGGAAGGGTTGGTGG + Intronic
1088200253 11:107324561-107324583 TCAACTGGACACAGGGCTAGAGG + Intergenic
1090437263 11:126697161-126697183 CCAGGTGAACACAGGTCTGGGGG - Intronic
1090776181 11:129968024-129968046 TCAGCTGCACACAGAGGTGGAGG + Intronic
1092296979 12:7208599-7208621 CCTGCTGAAGAAGGGGCTGGTGG + Exonic
1097706083 12:62869874-62869896 TCAGCTGAGAAAAGAGTTGGGGG - Intronic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1101541872 12:105672672-105672694 GCTGCTGAACAAGGGGCTGCAGG - Intergenic
1103145279 12:118590093-118590115 TCAGCTGTACTAAGGTCTGGAGG + Intergenic
1103443280 12:120978942-120978964 TGAGCTGCCCAATGGGCTGGGGG + Exonic
1104397926 12:128450903-128450925 TCAGCTGCACAAAGGTTTGAAGG - Intronic
1104428024 12:128693989-128694011 TCAGCCAGATAAAGGGCTGGAGG + Exonic
1106383108 13:29258929-29258951 TCATCTGAACACATGGCTGAAGG - Intronic
1108709157 13:53016140-53016162 TCTGCTAGACAATGGGCTGGTGG - Intergenic
1112002335 13:95222420-95222442 CCTGCTGAGCAAAGGGGTGGAGG + Intronic
1112792435 13:103017413-103017435 CCAGCTGAACCAATGGCTGCGGG + Intergenic
1114076019 14:19161601-19161623 TCAGCTGAACATCAGGCTGCAGG - Intergenic
1114553331 14:23546879-23546901 GCAGCTAAAGAAGGGGCTGGTGG - Intronic
1114605840 14:23995478-23995500 TCAGCTGAAAAGAGGACAGGTGG - Intronic
1115064303 14:29238244-29238266 CCAGCTAAACAAAGCACTGGAGG - Intergenic
1116171763 14:41411592-41411614 TGAGCTGAACAAAGTGCAGTTGG - Intergenic
1118044973 14:61959528-61959550 TCAGTTGCACAAAGCGTTGGGGG - Intergenic
1118383479 14:65236757-65236779 TTAGCTGAACAAAGGGATTCTGG + Intergenic
1118817219 14:69322084-69322106 TGAGATGAACACAGGGCTGGGGG + Intronic
1119212892 14:72846033-72846055 TTAGCTAAATAAAGGGGTGGTGG - Intronic
1120190800 14:81437470-81437492 GTAGCAGAACAAAGGTCTGGTGG - Intergenic
1121957309 14:98226292-98226314 CCAGCTGAGCCCAGGGCTGGAGG + Intergenic
1122352639 14:101104826-101104848 TGCCCTGAACCAAGGGCTGGGGG + Intergenic
1122401457 14:101469806-101469828 TCAGACGAAGAAAGGACTGGTGG - Intergenic
1122741288 14:103872803-103872825 ACAGCTGAAGAAGGGGCTGGAGG + Intergenic
1124249605 15:28098061-28098083 TCAGCTGCTCCAGGGGCTGGAGG + Intronic
1124455292 15:29836766-29836788 TGACCTGATAAAAGGGCTGGAGG + Intronic
1124470891 15:29984795-29984817 TCAGCTTCCCAAAGTGCTGGGGG - Intergenic
1124789599 15:32715758-32715780 TCAGCTGAACCAAATGCTGAGGG - Intergenic
1127866971 15:63041441-63041463 TCAGCTGATCTCAGGGCTTGGGG + Intergenic
1128335245 15:66781441-66781463 TCAGCTTCGCCAAGGGCTGGGGG + Exonic
1129790165 15:78335858-78335880 TTAGCTGAAGACAGGGATGGGGG - Intergenic
1131438517 15:92441420-92441442 TCAGCTGCACAAAGTGCTGCTGG + Intronic
1132802371 16:1760782-1760804 TTGGCTGATCAAAGGGCTGGAGG - Intronic
1133232886 16:4374681-4374703 TGAGCTGATCAATGGGCAGGCGG - Intronic
1133420383 16:5641672-5641694 TCAGCAGGGCAAAGGCCTGGAGG + Intergenic
1136057825 16:27703593-27703615 TCAGCTGAACTAAGGCCTACGGG - Intronic
1136406113 16:30048361-30048383 TCAGCTTCCCAAAGTGCTGGGGG + Intronic
1136755143 16:32675768-32675790 GCAGATCAACAAAGGGCCGGTGG - Exonic
1136812970 16:33194601-33194623 GCAGATCAACAAAGGGCCGGTGG + Exonic
1136819446 16:33304681-33304703 GCAGATCAACAAAGGGCCGGTGG + Intronic
1136826009 16:33361216-33361238 GCAGATCAACAAAGGGCCGGTGG + Exonic
1136831075 16:33459987-33460009 GCAGATCAACAAAGGGCCGGTGG + Intronic
1137029234 16:35506623-35506645 GCAGATCAACAAAGGGCCGGTGG - Intergenic
1137396788 16:48121816-48121838 GCAGCTGCAGAAAGGGGTGGTGG - Exonic
1137790999 16:51174664-51174686 TCAGGAGCAGAAAGGGCTGGAGG - Intergenic
1137970202 16:52977125-52977147 TCAGATGGCCAAAGGGCTGGAGG - Intergenic
1138008328 16:53357162-53357184 TCAGCTGAGAAATGGGGTGGGGG + Intergenic
1139470675 16:67176555-67176577 TCTGCTCAACAGAGAGCTGGAGG + Exonic
1141174719 16:81711190-81711212 CCAACAGAAAAAAGGGCTGGGGG - Exonic
1141562165 16:84876706-84876728 TCAGTTGAACTCAGGGGTGGAGG + Intronic
1141726624 16:85793559-85793581 GGAGATGAACAAAGGGCAGGAGG + Intronic
1142208986 16:88798739-88798761 CCAGCTGATCAAATGGATGGAGG + Intergenic
1142250958 16:88991792-88991814 TTACCTGAACACAAGGCTGGGGG + Intergenic
1202991547 16_KI270728v1_random:17571-17593 GCAGATCAACAAAGGGCCGGTGG + Intergenic
1142566061 17:841086-841108 TCAGCTGCAGAATGGTCTGGGGG + Intronic
1143379129 17:6484866-6484888 TGAGCAGAACAAAGTGCTGCAGG + Intronic
1146890383 17:36502773-36502795 TAATCTGAACAAAGGCCTAGAGG - Intronic
1147974878 17:44241387-44241409 GCAGAAGAAGAAAGGGCTGGAGG - Intergenic
1150764946 17:67995273-67995295 ACAGCTGAATAAAGTTCTGGTGG + Intergenic
1151427287 17:74039226-74039248 ACAGCTGATCAGAGGGCTGGGGG - Intergenic
1152067960 17:78121850-78121872 TCAGCAGATGAAAGGGCAGGTGG - Intronic
1152941242 17:83173837-83173859 TCAGATGAACAAAGGTCCTGTGG - Intergenic
1153182093 18:2446380-2446402 TGAGCTGAAAAAAGGGGTTGTGG + Intergenic
1153835096 18:8956556-8956578 TCAGTTGAACAGAGGGATGATGG - Intergenic
1154028327 18:10727174-10727196 TCTGCTCAACACAGAGCTGGAGG - Intronic
1156171856 18:34494440-34494462 TCTGCTGGACAGAGGGCAGGCGG + Intronic
1157518150 18:48325787-48325809 ACAGGTGAAGAAAGGGCTTGTGG + Intronic
1158825051 18:61209132-61209154 TCAGCTGACAGAAGGTCTGGTGG - Intergenic
1158888786 18:61853949-61853971 TCAGTTGAAAAATGGGCAGGTGG - Intronic
1158952255 18:62505305-62505327 TCTGCTGAACAGAGGGCTGGAGG - Intergenic
1159708246 18:71719194-71719216 TCAGCTGAACAGAGGCCTCCTGG - Intergenic
1160129685 18:76213692-76213714 TCAGACAAACAAAGGGTTGGGGG + Intergenic
1160219241 18:76960531-76960553 TCATCTGAACAAAGGGCTGGAGG - Intronic
1160385242 18:78492924-78492946 TCAGATGGACAAGGGGGTGGCGG - Intergenic
1160789773 19:918043-918065 TCAGCTGAACAAAGGGCTGGGGG + Intronic
1161165913 19:2787276-2787298 TGGGCTGGACAAAGAGCTGGGGG - Intronic
1161849968 19:6733101-6733123 TCAGCAGAGCATAGGGATGGGGG + Intronic
1162453707 19:10769735-10769757 TCAGCTGATAGCAGGGCTGGGGG + Intronic
1162939135 19:13997584-13997606 TCAGCAGCACAAAGCTCTGGAGG - Intronic
1163685850 19:18711245-18711267 TGAGCTGACCCAAGGCCTGGAGG - Intronic
1163819325 19:19487210-19487232 CCAGATGAACAAAGGGCAAGGGG - Intronic
1168137988 19:54364544-54364566 TCAGCTTTAAGAAGGGCTGGGGG - Intronic
1168159890 19:54503158-54503180 TCAGCTTTAAGAAGGGCTGGGGG + Intronic
1168629623 19:57946979-57947001 TCTTCAGAACTAAGGGCTGGGGG + Intronic
926145167 2:10392832-10392854 TGACATGAACGAAGGGCTGGGGG + Intronic
928787785 2:34910864-34910886 TCAGTTGAACCGATGGCTGGAGG + Intergenic
929828023 2:45325159-45325181 TCAACTGAACAGAAGGCTGAGGG - Intergenic
932345553 2:70993131-70993153 TCAGCTGCAGGAAAGGCTGGGGG - Intronic
932625014 2:73290702-73290724 ACAGCTCACCTAAGGGCTGGAGG - Intergenic
935387628 2:102517204-102517226 GCAGCTGCACACAGGGCTGCTGG + Intronic
935455758 2:103266012-103266034 TGAGATGAACAAAGGGCGAGAGG - Intergenic
935592819 2:104856644-104856666 GCTGCTGAACAAGTGGCTGGAGG + Exonic
935640603 2:105286409-105286431 TCATCTGAGCAGAGGGCAGGAGG - Intronic
935929760 2:108111777-108111799 TCAGGAGCACACAGGGCTGGTGG + Intergenic
940435735 2:153651643-153651665 GAAGCTGACCATAGGGCTGGTGG + Intergenic
941646780 2:168049060-168049082 GCATCTGGGCAAAGGGCTGGTGG - Intronic
942241869 2:173970273-173970295 GTAACTGATCAAAGGGCTGGAGG + Intergenic
942542077 2:177024924-177024946 TCAGCTGATCAAAGGGAAGGAGG + Intergenic
942544881 2:177053289-177053311 ACAGCTAATCAAAGGGCTTGGGG + Intergenic
943188694 2:184648038-184648060 TCAGCAGAACAAAGGCCAGATGG + Intronic
944615924 2:201460121-201460143 ACAGCTGAAGATAGGACTGGGGG - Intronic
947089801 2:226497043-226497065 TCATCTGAACAATGGGCTCATGG - Intergenic
947484877 2:230538806-230538828 TGAGTTGAAGAAAGGGCTTGGGG - Intronic
948330061 2:237157448-237157470 GGATCTGAACAGAGGGCTGGTGG + Intergenic
948685459 2:239666970-239666992 ACATCTGAGCAGAGGGCTGGAGG - Intergenic
948892890 2:240915820-240915842 TGAGCTGAAGAAGGTGCTGGGGG + Intergenic
1173904484 20:46616224-46616246 TTGCTTGAACAAAGGGCTGGGGG - Intronic
1174298574 20:49566535-49566557 TCAGCTGAAAAGATGTCTGGAGG + Intronic
1175595038 20:60224214-60224236 ACAGCTGTTCAAAGGGATGGAGG - Intergenic
1176378236 21:6097587-6097609 TCATCTGGACTAAGGGCAGGAGG - Intergenic
1176387634 21:6146806-6146828 TGAGCAGAACAAAAGGCTGAGGG - Intergenic
1177246812 21:18536304-18536326 TCAGCTTAACAAAGATCTAGAGG - Intergenic
1178787438 21:35666921-35666943 TCAACAGAGCAAAGGGCGGGGGG - Intronic
1179189671 21:39112988-39113010 TCCTCTGAACAACGGGCAGGGGG + Intergenic
1179735838 21:43391442-43391464 TGAGCAGAACAAAAGGCTGAGGG + Intergenic
1179745236 21:43440659-43440681 TCACCTGGACTAAGGGCAGGAGG + Intergenic
1181107197 22:20582409-20582431 TGAGGTGACCAAGGGGCTGGCGG - Intronic
1181623947 22:24109623-24109645 GTAGCTGAGCAAAGGGTTGGTGG + Intronic
1182109935 22:27715774-27715796 TGAGCTGATCCCAGGGCTGGGGG - Intergenic
1182966424 22:34525793-34525815 GCAGCTGAACAAAAGTATGGTGG - Intergenic
1184161226 22:42698473-42698495 TGGGCTGGACACAGGGCTGGAGG - Intronic
1184767447 22:46578973-46578995 GCAGCAGAGCAGAGGGCTGGTGG - Intronic
950037194 3:9895099-9895121 TCACTTGAACAAAGGGATGCAGG - Intergenic
950230840 3:11274492-11274514 TGAGATGAGCAAAGGGCTAGAGG + Intronic
950268455 3:11593466-11593488 TCAGCTTAACAAAAGGTTGGAGG - Intronic
950689111 3:14641633-14641655 TCAGCTGGACAAATGGTGGGAGG + Intergenic
951053550 3:18121746-18121768 TCAGCATGACAAAGAGCTGGTGG + Intronic
951692067 3:25406914-25406936 GCATCAAAACAAAGGGCTGGTGG - Intronic
952171331 3:30810620-30810642 TGAGCTGGACACAGGGCTGTAGG - Intronic
953310191 3:41869677-41869699 GCAGTTGTACAAAGGGTTGGAGG - Intronic
953404198 3:42652571-42652593 CAAGCTGCAGAAAGGGCTGGAGG - Intergenic
953697421 3:45170903-45170925 CCACCTGAGCAAAGGCCTGGGGG - Intergenic
953851847 3:46470662-46470684 TCAGGTGAATAAAGGAATGGTGG - Intronic
954142991 3:48619972-48619994 TCAGCTGAGAAGAGGGGTGGGGG - Intergenic
954634871 3:52065887-52065909 GCAGCTGAGCCCAGGGCTGGTGG + Intergenic
954822486 3:53342673-53342695 ACATCTGAACAAAGGCTTGGAGG - Intronic
955361626 3:58281166-58281188 TTAGCTGAACAAAAGGCAGCAGG - Intronic
955530825 3:59871483-59871505 TCATCTGAAAAATGGGGTGGAGG - Intronic
956632852 3:71332958-71332980 GCAGCTGAACTTAGGGCTGTGGG + Intronic
957349592 3:79006132-79006154 TTAGCTCATCAAAGGGCTCGTGG + Intronic
958802701 3:98775224-98775246 TCAGCTTCCCAAAGTGCTGGGGG - Intronic
960130025 3:114045780-114045802 TCAGTTGAACAATGTGATGGGGG - Intronic
961844679 3:129751643-129751665 TCACTTGAACACAGGGCCGGAGG - Intronic
964817177 3:160729545-160729567 TCTTCTGAACAAAGGGATTGGGG + Intergenic
966057712 3:175716541-175716563 TCAGCTCTACAAAGAACTGGAGG + Intronic
967372928 3:188769362-188769384 TAAGATGAGCAGAGGGCTGGGGG - Intronic
967995629 3:195164359-195164381 AGGGCTGAACAAAGGTCTGGAGG - Intronic
968615733 4:1577012-1577034 CCAGATGCACAGAGGGCTGGAGG - Intergenic
969336910 4:6516407-6516429 TCAGCTGCACAGAGGAGTGGTGG - Intronic
969543688 4:7810228-7810250 TCAGCACAACACAGGGCTGCTGG + Intronic
974999850 4:69209367-69209389 TCTCCTGAAGAAAGGCCTGGTGG - Intronic
975120417 4:70722250-70722272 TCAGCTGAAAAAAAAGGTGGGGG + Exonic
976005232 4:80422052-80422074 TCAGCAGACCTAAGGGCTGATGG + Intronic
976149810 4:82080399-82080421 TCACTTGAACCAGGGGCTGGAGG + Intergenic
978848609 4:113306384-113306406 TCAGCAGACCAAATGACTGGAGG - Intronic
979141895 4:117186164-117186186 TCACCTTAAAAAAGGGCTGGAGG + Intergenic
981108030 4:140903606-140903628 TAAGCCGGGCAAAGGGCTGGGGG - Intronic
982246784 4:153361089-153361111 TCAGCTTCCCAAAGTGCTGGTGG + Intronic
984755825 4:183324771-183324793 TCAGCTCAACTGGGGGCTGGAGG + Intergenic
985150859 4:186945743-186945765 TCAGCTGAGGAGAGGCCTGGGGG + Intergenic
985550874 5:532968-532990 TGGGCTGAGCAAAGGGCTCGGGG + Intergenic
986233273 5:5885844-5885866 ACAGTTGCACAAAGGGCTGAGGG - Intergenic
989365497 5:40651383-40651405 TCAGGTGAAAAGAGGGCAGGAGG - Intergenic
990279353 5:54232785-54232807 TCAGCCGAACAAGGGGCTGAGGG - Intronic
992009369 5:72511530-72511552 TCATCTGTAAAAAGGGCAGGGGG - Intergenic
992663695 5:78985282-78985304 TCAGCGGTACAAGGGGCTGGTGG - Exonic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
999246093 5:150155566-150155588 TCAGGAGAACAGAGGGATGGAGG + Exonic
999553526 5:152716545-152716567 TCAGATGAACAAAGATCTGAAGG - Intergenic
1001399739 5:171439382-171439404 ACAGCTGGCCAGAGGGCTGGAGG + Intronic
1001492429 5:172165122-172165144 TCAGCTGCACAAAGGCCAGCAGG + Intronic
1001683437 5:173575555-173575577 ACAGCTGCTCAAGGGGCTGGGGG - Intergenic
1001819410 5:174698372-174698394 ACAGCTGAACAAAGGCCTGTGGG - Intergenic
1004918565 6:20355411-20355433 TCAACTGGACATGGGGCTGGGGG + Intergenic
1004977796 6:20987505-20987527 TCAGCTTCCCAAAGTGCTGGGGG + Intronic
1007635590 6:43298005-43298027 TCTGCTGACCAAGGGGCTAGGGG + Intronic
1007935833 6:45731084-45731106 TGATCTGCACAAAGGGGTGGTGG + Intergenic
1012762666 6:103321482-103321504 TCAGCTAATCACAGGGGTGGAGG + Intergenic
1015576465 6:134676933-134676955 TCAGCAGGCCAAAGGGCTGTGGG - Intergenic
1015619723 6:135118461-135118483 GCAGATGAAGAAAGGGCAGGGGG - Intergenic
1015803892 6:137089570-137089592 TCAGGTAATGAAAGGGCTGGAGG + Intergenic
1018591637 6:165431657-165431679 TCATCTCAACAAAGGACTCGGGG + Intronic
1019213310 6:170423380-170423402 TCAGCTGCACACAGGGCCAGAGG - Intergenic
1019904335 7:4049302-4049324 ACAGCAGAACAAATGGCAGGAGG - Intronic
1021777922 7:24072261-24072283 CCAGCTAAACAGAGGGCAGGAGG - Intergenic
1023418404 7:39951834-39951856 TCACCTGAGCACAGGGCTGTAGG - Exonic
1024531073 7:50393172-50393194 TCAGAGGAACATAGGGCTGGGGG + Intronic
1025607244 7:63048083-63048105 GCAGATCAAAAAAGGGCTGGTGG - Intergenic
1026329748 7:69341464-69341486 TCAGATGCACAGAGGGCAGGTGG + Intergenic
1026478332 7:70756899-70756921 TCAGCTGCACAAATGTCGGGTGG + Intronic
1029168894 7:98617250-98617272 TCAGCTTAAGAAAGGGCGCGCGG + Intergenic
1032187970 7:129743961-129743983 TCAACTGAACTAAGATCTGGTGG + Intronic
1032907137 7:136381342-136381364 ACAGCTAGGCAAAGGGCTGGTGG + Intergenic
1036125065 8:6055014-6055036 TGAGCTGAAGAAAGGGCAGAAGG + Intergenic
1042230407 8:66548649-66548671 TCTGGTGAACACAGGGTTGGCGG + Intergenic
1042276146 8:67007285-67007307 GCAACTGAACAAGGGGGTGGTGG - Intronic
1044671600 8:94686487-94686509 TAACCTGAACAAAGAGCTGAAGG - Intronic
1045171785 8:99678497-99678519 ACAGGTGCACAAAGGGTTGGGGG - Intronic
1046019998 8:108653336-108653358 GCTGCAGAACAAAGCGCTGGAGG + Intronic
1046647556 8:116802729-116802751 TTAGTTAAACAAAGGGCTTGTGG - Intronic
1047476491 8:125236963-125236985 TAAGTAGAACAAAGGGCTGTAGG + Intronic
1048171567 8:132111523-132111545 TCTTCTGAAGAAAGGGCTGGGGG + Intergenic
1048867814 8:138773599-138773621 TCAGCTCAACACACGGCTGCAGG - Intronic
1050203756 9:3176459-3176481 CCAGCTAAGCAAAGAGCTGGAGG - Intergenic
1050555700 9:6788100-6788122 TCGGAGGAACAAAGGGCTGAAGG - Intronic
1051638390 9:19202380-19202402 TGATCTGAACAAAGGGCAGCTGG + Intergenic
1053266158 9:36714954-36714976 TCAGTTGAACAAAGGAATGATGG - Intergenic
1053449489 9:38181199-38181221 GGAGCAGAACAAAAGGCTGGTGG + Intergenic
1055656221 9:78452762-78452784 TGCGCTGAACAAAGCCCTGGAGG - Intergenic
1056450836 9:86715466-86715488 AGACCTGAAGAAAGGGCTGGTGG + Intergenic
1058595957 9:106615844-106615866 GCAGATGAAAAAAGGGCTTGGGG + Intergenic
1059563580 9:115359649-115359671 TCAGCTGAACTGAGGTCTGAAGG + Intronic
1060274751 9:122174001-122174023 TCAGGTGGACAAGGGGCAGGTGG - Intronic
1190688057 X:52891672-52891694 GAAGCTGAACAGAAGGCTGGAGG + Intronic
1190697925 X:52964120-52964142 GAAGCTGAACAGAAGGCTGGAGG - Intronic
1191941368 X:66484802-66484824 ACAGCTGAACAAAGATGTGGTGG + Intergenic
1193601110 X:83509074-83509096 CCTGCTGAACAAGTGGCTGGAGG + Exonic
1197928552 X:131672198-131672220 TCAGCTGAACCAAGGTATGGTGG + Intergenic
1199076517 X:143532321-143532343 TCAGCAGAACAATGTGCTGCTGG + Intergenic