ID: 1160789775

View in Genome Browser
Species Human (GRCh38)
Location 19:918047-918069
Sequence CTGAACAAAGGGCTGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 493}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160789762_1160789775 12 Left 1160789762 19:918012-918034 CCCCGGTGCAGCGCGGGCCAACG 0: 1
1: 0
2: 3
3: 4
4: 45
Right 1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG 0: 1
1: 0
2: 4
3: 49
4: 493
1160789763_1160789775 11 Left 1160789763 19:918013-918035 CCCGGTGCAGCGCGGGCCAACGG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG 0: 1
1: 0
2: 4
3: 49
4: 493
1160789767_1160789775 -5 Left 1160789767 19:918029-918051 CCAACGGCTCGGTGTCAGCTGAA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG 0: 1
1: 0
2: 4
3: 49
4: 493
1160789759_1160789775 28 Left 1160789759 19:917996-918018 CCACTCGCGGGGCTCGCCCCGGT 0: 1
1: 0
2: 3
3: 1
4: 67
Right 1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG 0: 1
1: 0
2: 4
3: 49
4: 493
1160789765_1160789775 10 Left 1160789765 19:918014-918036 CCGGTGCAGCGCGGGCCAACGGC No data
Right 1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG 0: 1
1: 0
2: 4
3: 49
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160789775 Original CRISPR CTGAACAAAGGGCTGGGGGA GGG Intronic
900618518 1:3576404-3576426 TTGAACAAAGGAGTTGGGGAGGG - Intronic
900750898 1:4396758-4396780 CAGAACAAAGGGCTGAGGCATGG + Intergenic
900932382 1:5745561-5745583 ATGATCAAAGGGCTGTTGGAAGG - Intergenic
901040315 1:6359469-6359491 CTGAAGCAGGGGTTGGGGGAAGG - Intronic
901219325 1:7574215-7574237 CTGAGCCAAGGGCTGGGAGCTGG + Intronic
901233812 1:7656712-7656734 TAGAAGAGAGGGCTGGGGGAAGG - Intronic
902822178 1:18950108-18950130 TGGGAGAAAGGGCTGGGGGATGG + Intronic
903103126 1:21050943-21050965 CTGAATAAGGGGATGGGGTAGGG + Exonic
903283716 1:22264474-22264496 GTGAAAAAGGGGTTGGGGGAGGG - Intergenic
903426194 1:23256233-23256255 GAGAAAAAAGGGCTGGGGGAAGG - Intergenic
903577820 1:24350139-24350161 CTGAGCAACCAGCTGGGGGAGGG - Intronic
903605224 1:24570670-24570692 CTGAGCAGGGGCCTGGGGGAGGG - Intronic
903766053 1:25735035-25735057 TTGAAGAAAGGGCTGGAGGCTGG + Intronic
903994880 1:27299530-27299552 GTGAACAAAGGCATGGGGGTGGG + Intronic
904318557 1:29681707-29681729 ATGAACAAAGGCCTGGAGGCAGG + Intergenic
904356277 1:29942151-29942173 ATGAGCATAGGCCTGGGGGAGGG - Intergenic
904438931 1:30517276-30517298 ATGAACAAAGGCCTGGAGGCAGG - Intergenic
904625461 1:31799656-31799678 CTCCCCAAAGGGGTGGGGGAAGG - Intronic
904948464 1:34216458-34216480 CTGAACAAAGTGCTGGTGTTGGG + Intronic
905516163 1:38563565-38563587 CTGAACCAGAGGCTGCGGGAAGG + Intergenic
905866423 1:41379489-41379511 CTGAACACAGGTGTTGGGGAGGG + Intronic
906048238 1:42849638-42849660 ATGAACAAAGGGATGAGGGAGGG - Exonic
906061574 1:42952560-42952582 CAGCACACAGGGCTGTGGGATGG + Intronic
906533005 1:46534127-46534149 CTGAATAAGGGGGTGGGGGTGGG - Intergenic
906725067 1:48038434-48038456 CTGAACAAAGACCTGGAGGCAGG + Intergenic
906978583 1:50603626-50603648 CAAAAAAAATGGCTGGGGGAAGG - Intronic
907048363 1:51313663-51313685 CTGGGCAAAGGCCTGGAGGAGGG - Intronic
907053731 1:51345980-51346002 TTGAACACAGGGCAGGGGCAGGG + Intergenic
909205264 1:72748553-72748575 ATCAACAAAGGCATGGGGGAAGG - Intergenic
909815292 1:79984946-79984968 CCGAACAAAGGGTTGGAAGAGGG + Intergenic
911176471 1:94822576-94822598 CTGGACAAAGGCTTGGGGGAAGG + Intronic
911664546 1:100538813-100538835 CAGAATAATGGGCTGGGGGAGGG - Intronic
912175183 1:107146301-107146323 CTTTCCAAAGGGCCGGGGGATGG - Intronic
912430037 1:109624149-109624171 CTGGACAAAGGGAAGAGGGAGGG - Intronic
913521833 1:119651851-119651873 CTGAGAAAAGGGGTGTGGGAAGG + Intergenic
914878650 1:151530735-151530757 CTGAACAAGGAGGTGGGGCATGG + Exonic
915102923 1:153513720-153513742 CTGGACAAGGGGCTGGTGGTTGG - Intergenic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915508764 1:156374260-156374282 CTGGACAAATGGTTGGGGGGTGG - Intronic
916449859 1:164910170-164910192 CAGAACAAAGGGATGAAGGAAGG - Intergenic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
917160543 1:172052256-172052278 CTGATCAAGGGGGTGGGGGGTGG + Intronic
917457657 1:175199285-175199307 CTGAACAAAGGTGTGGAGAAGGG + Intergenic
918139633 1:181709536-181709558 ATGAATGAGGGGCTGGGGGATGG - Intronic
918400255 1:184155927-184155949 GTGAACAAGGGGCTAGGGAATGG + Intergenic
919367571 1:196683537-196683559 TTGAACAAAGGGTTGAGTGAAGG + Intronic
920129752 1:203723063-203723085 CAGAACAAAGGGCAGGGACAGGG - Intronic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
921354926 1:214276912-214276934 CTGAACAAAGTGCAGTAGGAAGG - Intergenic
922797431 1:228347379-228347401 CTGAACTGAGTGCTTGGGGAGGG - Intronic
922815613 1:228446734-228446756 CTTAACAAAGGGCGGGAGGGTGG - Intergenic
924367181 1:243307285-243307307 CTAAAGAAAGGGCTGGGGAATGG - Intronic
924397427 1:243637120-243637142 CTGAATAAAGGTATGGGGGTGGG + Intronic
924937435 1:248784041-248784063 CTTAGTAAAGGGCTGGGGGTGGG - Intergenic
924941611 1:248816113-248816135 CAGAAAAAAGGGGTGTGGGATGG + Intronic
1063503891 10:6579690-6579712 CTGGTCAAGGGCCTGGGGGAGGG - Intronic
1065148643 10:22799079-22799101 ATGAAAAAAGGGCGGGGGGTGGG + Intergenic
1065923192 10:30411475-30411497 CTGCAGTCAGGGCTGGGGGAAGG - Intergenic
1068425847 10:56862822-56862844 CTAAACAAAGGTCAGGGGAATGG - Intergenic
1068892772 10:62165044-62165066 ATGAGCAAAGGCCTGGGGGTGGG - Intergenic
1070746685 10:78937921-78937943 CTAAACAATAGGCTGGGGGAGGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1070833757 10:79435592-79435614 CTGGAATTAGGGCTGGGGGATGG - Intronic
1070888205 10:79922964-79922986 CTGAACAACGGGCTCTGGAATGG + Intergenic
1071342867 10:84664650-84664672 CTCCACAATGGGCTGGGGAAGGG + Intergenic
1071510532 10:86259700-86259722 CTGCACAAATGGCAGGGGCAGGG + Intronic
1071815156 10:89225016-89225038 CTGAAGAAATGGCAAGGGGAGGG - Intronic
1072560355 10:96567574-96567596 TGGAGGAAAGGGCTGGGGGATGG - Intronic
1072799641 10:98384156-98384178 CAGAATAAGGGGCTGGGGGGAGG + Intronic
1073466890 10:103699555-103699577 CTGAGCAAAGGGCTGGGCGAAGG + Intronic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1073724203 10:106210826-106210848 CGGAACAAAGGGCAGGTAGAAGG - Intergenic
1073969817 10:109034656-109034678 GTGAATCAAGGGCTGGGGAAAGG - Intergenic
1074868128 10:117556702-117556724 CTGGACAAAAGGATGGGTGACGG - Intergenic
1074876397 10:117616851-117616873 CTCAGCAAGGGGCTGTGGGAGGG - Intergenic
1075616668 10:123894814-123894836 CTGAACCATGGGCTGAGTGATGG - Intronic
1076008607 10:126968318-126968340 ATGAACAAAGGGCTAGGGGCTGG + Intronic
1076310005 10:129498734-129498756 CTGAATCCAGGGCTGGGGCAGGG - Intronic
1076798125 10:132808633-132808655 CTGCACCAAGGGCTGGGGAGAGG + Exonic
1077034698 11:489003-489025 CTAAGGAAAGGCCTGGGGGACGG + Intronic
1077135562 11:996510-996532 GTGATCAAAGGCCTGGGGTATGG - Intronic
1077324582 11:1958271-1958293 CTGCACTCCGGGCTGGGGGAGGG - Intronic
1077881599 11:6354836-6354858 CTGGACAAAGGGCACAGGGATGG - Intergenic
1078447692 11:11416897-11416919 CAGGAGCAAGGGCTGGGGGAGGG - Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079081556 11:17416876-17416898 CTCAACAAAGGGAAGGGGTAGGG - Intronic
1079104280 11:17560501-17560523 CTGAGCAAAGGTCTAGGGGTGGG + Intronic
1079590334 11:22175846-22175868 TTTATCAAAGGGCTTGGGGAAGG - Intergenic
1080131336 11:28798433-28798455 AAGAACAAAAGGCTGAGGGAAGG + Intergenic
1080235372 11:30062528-30062550 CTGACAAAGGGCCTGGGGGAGGG - Intergenic
1080890564 11:36405537-36405559 CATAACAAAGGGCTGTGGGGAGG - Intronic
1081591609 11:44427077-44427099 CAGAACACAAGGCTGGGGAAAGG + Intergenic
1081806938 11:45896027-45896049 CTGCACAGAGGGGTGGGGAATGG - Intronic
1081991113 11:47338168-47338190 GTGTACAAAGGGGTGGAGGAGGG - Intronic
1082771779 11:57213504-57213526 AGGAACAAAGGCTTGGGGGAGGG - Intergenic
1082771893 11:57214281-57214303 AGGCACAAGGGGCTGGGGGATGG - Intergenic
1082928829 11:58578956-58578978 CTGAAGGAAGGGGTGGGGGAGGG + Intergenic
1083552305 11:63599077-63599099 CTGCACTGAGTGCTGGGGGAGGG + Intronic
1083593912 11:63910063-63910085 CTGACCCCAGGGCTGGGAGAGGG + Exonic
1083603337 11:63962144-63962166 GTGAACAAGGGCCTCGGGGAAGG - Intergenic
1083679067 11:64342960-64342982 CTGCACAAAGGGCGGGGCCAGGG + Intronic
1085530393 11:77189167-77189189 CTGAGCCAAGGGCTGGGGTCTGG - Intronic
1085635540 11:78156731-78156753 CTGCACAAAGGGCTGAGTGGGGG + Intergenic
1086013645 11:82137508-82137530 CCAAAGAAAGGGCTGGGGAAGGG + Intergenic
1087118270 11:94545662-94545684 CTGTACAGAGGGCTGGGGACCGG + Exonic
1087127387 11:94641319-94641341 CTGAACGAAGGGATGTGGGCAGG - Intergenic
1088919542 11:114251186-114251208 GGGAACAAAGAGCTGGAGGAGGG - Intergenic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089288014 11:117420071-117420093 CTGTAGAAATGCCTGGGGGAGGG + Intergenic
1089524724 11:119089472-119089494 CTGCAAGAATGGCTGGGGGAGGG + Intronic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090743793 11:129691339-129691361 CTGAGCAGGAGGCTGGGGGAGGG - Intergenic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1202807561 11_KI270721v1_random:13448-13470 CTGCACTCCGGGCTGGGGGAGGG - Intergenic
1091384015 12:80817-80839 CTGAGCAAAGTCCTGGAGGAGGG + Intronic
1091593999 12:1863134-1863156 CTGAATAAATGTATGGGGGAGGG - Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1091773521 12:3169246-3169268 TTGACCTCAGGGCTGGGGGAAGG + Intronic
1091928463 12:4375001-4375023 CAGCACTAAGGGCTCGGGGAAGG + Intronic
1092798733 12:12141183-12141205 AAGAGGAAAGGGCTGGGGGAGGG + Intronic
1094039365 12:26106773-26106795 CAGAAATATGGGCTGGGGGAAGG - Intergenic
1095959186 12:47823321-47823343 CTGAACTGAGGCCTTGGGGAAGG - Intronic
1097244953 12:57602658-57602680 CTGGAAAAAGGGGTGGGAGAAGG - Exonic
1097713334 12:62938407-62938429 AGGAACAGGGGGCTGGGGGAGGG + Intergenic
1098540901 12:71656110-71656132 GTGAACTAAGGGCTGAGGGACGG + Intronic
1098904247 12:76145554-76145576 CTGAACACATAGCTGGGAGATGG - Intergenic
1100315370 12:93441083-93441105 TTTAACACAAGGCTGGGGGAGGG - Intronic
1100381937 12:94070600-94070622 TTGAGCAAAGGCCTGGAGGAGGG + Intergenic
1102412903 12:112735751-112735773 CTGAAGAAAGGCTTGGGGGGAGG - Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102564017 12:113782947-113782969 CTGATCGAAGGGCGGGAGGAAGG - Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1105213372 13:18270973-18270995 CTGCACAAAGGTCTGGGGGCCGG - Intergenic
1105564285 13:21528874-21528896 ATGAACAGAAGGCTGGGAGAAGG + Intronic
1106179154 13:27356231-27356253 CTGGACAAAGGCCTGGGAGCAGG - Intergenic
1107561252 13:41559277-41559299 CTGAACAAATAGCTGTGGGATGG - Intergenic
1108081146 13:46737522-46737544 CAGCACAAAGGGATGTGGGATGG - Intronic
1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG + Intergenic
1110484337 13:76020125-76020147 CTGAGCACAGGCCTGGGGGGTGG + Intergenic
1112059804 13:95727074-95727096 TTGAACAAAGGCCTGGGCTAGGG - Intronic
1112359789 13:98707051-98707073 CTGAACAAAGGTATGGAGGCAGG - Intronic
1113034818 13:106037366-106037388 CTGAAATCAGGGCTGGGGAAGGG - Intergenic
1113361963 13:109640031-109640053 CTAAAAAAAGGGTGGGGGGAAGG + Intergenic
1113724416 13:112587778-112587800 CCGGGCAGAGGGCTGGGGGACGG - Intronic
1113826537 13:113259397-113259419 TTGAAATGAGGGCTGGGGGAAGG - Intronic
1114264372 14:21063758-21063780 TGGAGCAAAGGGCTGGGGGTAGG + Intronic
1114673660 14:24428012-24428034 CTGAGCTAAGGGCTGGGGAATGG - Intronic
1116497155 14:45574927-45574949 TTGACCAAAGGGATGAGGGAAGG - Intergenic
1117077169 14:52116367-52116389 TTGAACAAAGGGGAGGGGGTGGG - Intergenic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1118802920 14:69207455-69207477 CTGCACACAGGTCTGGGCGACGG + Intronic
1120169482 14:81234486-81234508 CTTGCCAAAGGGCTGGGGGGTGG + Intergenic
1120402146 14:84045300-84045322 GGGAATAAAGAGCTGGGGGAAGG - Intergenic
1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG + Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1121381561 14:93474453-93474475 CTGAGCAAGGGGCTTGGAGATGG + Intronic
1122117947 14:99536951-99536973 CAGGGCAGAGGGCTGGGGGAAGG + Intronic
1122130464 14:99602225-99602247 CTGAGCAGGGGGCTGGGAGAGGG + Intronic
1125335779 15:38624960-38624982 TTTAAAAAAGGGGTGGGGGAAGG - Intergenic
1125874981 15:43136033-43136055 CAGAAAAAAGGACTGGGGGATGG - Intronic
1126382928 15:48066908-48066930 CTGAACAAAGGCAGTGGGGAGGG + Intergenic
1126932999 15:53675821-53675843 TTGAATAAAGTGCTGGGTGAGGG + Intronic
1127254811 15:57280703-57280725 CTGAAAAAATGGTTGGGGGTGGG + Intronic
1127530656 15:59840453-59840475 CTGAACAAAGGACCAGAGGAAGG - Intergenic
1127940338 15:63688873-63688895 CAAAAAAAGGGGCTGGGGGAAGG + Intronic
1128160778 15:65421903-65421925 CTGGAGAAAGGGCTGGGGAGGGG - Intronic
1128311772 15:66635414-66635436 CTGAGCAAAGGTTTGGGGGCTGG - Intronic
1128539705 15:68518011-68518033 TGGAACACAGGGCTGGGGGAAGG + Intergenic
1129518388 15:76170747-76170769 CTGAACTAAGGGCTGGAGATGGG + Intronic
1129758364 15:78112163-78112185 CTGAATAATGGGCAGGGGGCGGG - Intronic
1130146226 15:81275540-81275562 TTAAACAAAGGGGTGGGGGAAGG + Intronic
1130754912 15:86752971-86752993 CTGAAGAAAGGGCGGGAGCAAGG - Intronic
1130887306 15:88104639-88104661 CTGCAGAAAGGACTGGGAGAGGG - Intronic
1130896139 15:88171810-88171832 CTGAACGAATGACTGAGGGAGGG - Intronic
1131134622 15:89924343-89924365 CTCAACAAAGGGATGGGGAAGGG + Intergenic
1131538072 15:93253904-93253926 GGGAACAAAGGGCTTGGAGAAGG + Intergenic
1131901609 15:97094062-97094084 CTAAAAAAAGGGCAGGGGGCTGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1132878075 16:2149028-2149050 CTGAGCCAAGGGTTGGGGGTCGG + Intronic
1134087379 16:11367205-11367227 TTGAACCCAGGGCGGGGGGAGGG - Intronic
1134090504 16:11389112-11389134 CTGCACAAAGGCCTGGGAGAGGG - Intronic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136383462 16:29908121-29908143 TTGACCAAAGGAGTGGGGGAGGG + Intronic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1137392262 16:48091593-48091615 TTGAGCAAGGGGCTAGGGGAGGG - Intronic
1137538068 16:49342428-49342450 CTGGACCAGGGGCTGGGGGTGGG + Intergenic
1137626984 16:49915297-49915319 CTGAGCAAAGGGTGGGGGAAAGG - Intergenic
1138597860 16:58038662-58038684 CTGCAGCAAGGGATGGGGGATGG + Intronic
1139234380 16:65319069-65319091 CTGAATAAAGGCCTGGAGGCAGG + Intergenic
1139369465 16:66457854-66457876 CTTCAAGAAGGGCTGGGGGAGGG - Intronic
1139424285 16:66869534-66869556 GTGAACACACAGCTGGGGGAGGG + Intronic
1139459121 16:67108226-67108248 CAGAAAAAAAGGCCGGGGGAGGG + Intergenic
1139834118 16:69824524-69824546 AGGAACAAAGGGAAGGGGGAGGG - Intronic
1139845286 16:69916691-69916713 CTGAAGAAAGGCCTGGGTGTGGG + Intronic
1140201918 16:72901907-72901929 CTTAAAAAGGGGGTGGGGGAAGG - Intronic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140879689 16:79186853-79186875 TTGAAAAACTGGCTGGGGGATGG - Intronic
1141236679 16:82224763-82224785 ATGAACAAAGTGATGGAGGAAGG - Intergenic
1141678439 16:85529999-85530021 CTGCACAAGGGGCTGGGCAAAGG - Intergenic
1141896234 16:86960334-86960356 CTCCACGAAGCGCTGGGGGAGGG - Intergenic
1142028995 16:87829177-87829199 CTAAAGAAAGGGCTGCGGGGAGG + Intergenic
1142030024 16:87833820-87833842 CTGCACACAGGGCCGGGGGGCGG + Intronic
1143456581 17:7071738-7071760 CTGAAATAAGGGCTGGAGGTGGG + Intergenic
1143499856 17:7332293-7332315 CTGAATTCAGGGCTGAGGGAAGG - Intergenic
1143751688 17:9032740-9032762 CTGGCCAAAGGGCTGAGGGTAGG - Intronic
1143781533 17:9231978-9232000 CTGAACAAAGGCATCGGTGAGGG - Intronic
1144628198 17:16856274-16856296 GTGCACAGAGGGCTGGGGGCTGG + Intergenic
1144741065 17:17582531-17582553 CACAACAAAGGGCAGGGGAATGG + Intronic
1145159790 17:20566841-20566863 GTGCACAGAGGGCTGGGGGCTGG + Intergenic
1145179543 17:20734533-20734555 CTCAACAAAGCTCTGGGTGAAGG - Intergenic
1145736962 17:27239906-27239928 CTGAAGGAAGGGCAGGGGGCGGG - Intergenic
1146052919 17:29567156-29567178 CTGTACAAAGGGCCGGGGCGGGG - Intronic
1146902994 17:36600380-36600402 GTGAAAAATGGGCTGGGGAAAGG + Exonic
1146911284 17:36649939-36649961 CTGACCTGGGGGCTGGGGGAGGG + Intergenic
1147363674 17:39946617-39946639 CCGACCAAAGGGGTGGTGGAGGG - Intergenic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1147610802 17:41800971-41800993 CTGGAAAAAGGGCTGGGTCAAGG - Intergenic
1147610817 17:41801023-41801045 CCGATCAAAGGCCTAGGGGAGGG + Intergenic
1147995257 17:44356563-44356585 CTGCACCAAGGGCTGGGAGCGGG + Exonic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1148509088 17:48153643-48153665 CTAATCAAAGGGGTGGGTGAGGG - Intronic
1148885602 17:50770096-50770118 CTGATCGCAGGGCTGGGGCAGGG - Intergenic
1150294310 17:63999517-63999539 GTGCACATAGGGTTGGGGGATGG + Intronic
1150312112 17:64137224-64137246 CTGAACAAAGGCCTGGGGAAAGG + Intergenic
1152307365 17:79529205-79529227 CAAAACAAAAGCCTGGGGGATGG + Intergenic
1152335786 17:79699701-79699723 CTGAACCAAGGGTTGGGGTGAGG - Intergenic
1152371783 17:79892864-79892886 TTGGACAAAGTGCTGGGGGTTGG - Intergenic
1152641346 17:81450550-81450572 CTGAACACAGGTCAGGAGGAAGG - Intronic
1152893460 17:82896090-82896112 CTGAAGAAGGGGGTGTGGGAGGG - Intronic
1153572366 18:6486128-6486150 CAGTACAGAGGGCTGGGGGTGGG - Intergenic
1155572404 18:27210299-27210321 CTGAAGAAAGGAATGGGGGGAGG + Intergenic
1156205393 18:34880506-34880528 CTGACCCAAAAGCTGGGGGAGGG + Intronic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157364995 18:47056456-47056478 TTGAACAGATGGCTGGTGGAGGG + Intronic
1157518152 18:48325791-48325813 GTGAAGAAAGGGCTTGTGGAGGG + Intronic
1158658049 18:59359002-59359024 CGGAGCAGAGGGCTGGGGGCCGG - Intronic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160335071 18:78031527-78031549 CAGAGAAATGGGCTGGGGGAGGG - Intergenic
1160429584 18:78802224-78802246 CAGGAGAAAGGGATGGGGGAGGG + Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160975870 19:1792124-1792146 CTGGGCAAAGGCCTGGGGGCCGG + Exonic
1161219066 19:3109642-3109664 CTGAGCAAAGCTCTGGGGAAGGG + Intronic
1161849455 19:6731100-6731122 CTCCACCAAGAGCTGGGGGACGG + Exonic
1162925575 19:13929361-13929383 CTGATCTAAGGGGTGGAGGAAGG - Exonic
1162958565 19:14113198-14113220 CTAAACCCAGGGGTGGGGGAGGG + Intronic
1163241442 19:16066436-16066458 CGGCACAAAGGCCTGGGGGTGGG + Intergenic
1164649683 19:29882852-29882874 CTGAAATGAGGGCTGGGGGCAGG - Intergenic
1164675064 19:30095321-30095343 CTGCACACTGGGCTGAGGGAGGG + Intergenic
1165351701 19:35279307-35279329 CTGTGCTAAGGGCTGGGGAAGGG - Exonic
1165891262 19:39113617-39113639 CTGAGCAAAGGCCTGAGGGGGGG - Intergenic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166392789 19:42419343-42419365 CTGCACAAAGGAGTGGGGAAGGG + Intronic
1168599656 19:57707688-57707710 GGGAACAAAGAGCAGGGGGAAGG - Intronic
924986685 2:277395-277417 CTGAACAAAGAGCTGGGCTTTGG - Exonic
925750961 2:7090290-7090312 CTGAGGAAAGGCCTGGGGCAGGG + Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
927279155 2:21288482-21288504 GTGAACAAAGGGCTGTAGGCAGG + Intergenic
927406548 2:22776763-22776785 TTAAACATAGGGCAGGGGGAAGG + Intergenic
927412064 2:22837926-22837948 TTTAACAAAGGGCATGGGGAGGG + Intergenic
927847941 2:26480904-26480926 CTGAACGAGGGCCTGGGGGAGGG - Exonic
927945650 2:27133710-27133732 CTGCAGAAAGTGCTGTGGGAGGG + Exonic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
928790604 2:34947785-34947807 CAGACCAGAGGGCTGTGGGATGG + Intergenic
929316623 2:40486871-40486893 CTCTACAAAGGGGTGGGGGGAGG - Intronic
931771708 2:65503278-65503300 CTGAAGAAAGTGCTGTGGAAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932785419 2:74597477-74597499 CAGAAAAAAGGGCTGGGGGTGGG - Intronic
934300951 2:91775771-91775793 CTGCACAAAGGTCTGGGGGCCGG + Intergenic
934554465 2:95279997-95280019 CGTAAGAAAGGGCTGGGAGAGGG + Exonic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
935236341 2:101141479-101141501 CTGAACGCTGGGTTGGGGGAGGG + Intronic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
935831445 2:107004963-107004985 CTGAAGGATGGGCTGAGGGAGGG + Intergenic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
936610792 2:114000286-114000308 CGGAACAAAGGACTGGGTGATGG - Intergenic
937395284 2:121529968-121529990 CAGTACAAAGGTATGGGGGAGGG + Intronic
937914735 2:127093234-127093256 CTGAACAAAGGGCATGTGAAAGG + Intronic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
938201427 2:129376022-129376044 CTGAACACAGGGCTGAGGGTTGG - Intergenic
938384522 2:130854763-130854785 CAGAACACAGAGCTGGGGGTGGG - Intronic
945908985 2:215625044-215625066 CATTAAAAAGGGCTGGGGGAGGG + Intergenic
946039727 2:216773360-216773382 CTGAGCAAAGTGCTTGGAGAGGG + Intergenic
947484875 2:230538802-230538824 TTGAAGAAAGGGCTTGGGGGAGG - Intronic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
948685457 2:239666966-239666988 CTGAGCAGAGGGCTGGAGGGTGG - Intergenic
948892891 2:240915824-240915846 CTGAAGAAGGTGCTGGGGGCAGG + Intergenic
1169073084 20:2745627-2745649 CTGAGCAAAGGCTTGGGGAAGGG + Intronic
1169983876 20:11420455-11420477 CTGAACAATGGGCACAGGGAGGG - Intergenic
1170334386 20:15252089-15252111 GTGAACAAAGGGCTAAGGTAAGG + Intronic
1170868932 20:20187041-20187063 CTGAACACCTGGGTGGGGGATGG + Intronic
1171817861 20:29804548-29804570 GTGAACACAGGGTTGGGGGTAGG - Intergenic
1172106740 20:32521665-32521687 ATGAAAAAAGGGCTGGGTGGGGG + Intronic
1172233847 20:33356100-33356122 CTGAAGAAAGGACTAGGGTAAGG + Intergenic
1173144899 20:40515991-40516013 CTGAAGAAGGAGCTGGGCGAGGG - Intergenic
1173345259 20:42193311-42193333 CTGAACAGAGGCCTGGGGCCAGG - Intronic
1174046297 20:47736304-47736326 CAAAACATAGGGGTGGGGGATGG - Intronic
1174110227 20:48193644-48193666 GTGAACAGAGACCTGGGGGACGG - Intergenic
1174281995 20:49446079-49446101 CTGATCAAATGGCTGAGTGACGG - Intronic
1174407199 20:50310171-50310193 CTGAGCAAAGGGCAGGGGCGGGG - Intergenic
1174555687 20:51393883-51393905 CAGAACACAGGGCTGGGGCAGGG + Intronic
1174606421 20:51765173-51765195 TAGAACTAGGGGCTGGGGGATGG - Intronic
1174789246 20:53462511-53462533 CTGAAGCCAGGGCTGGGGCAGGG - Intronic
1175176618 20:57116146-57116168 CTGGACACAGGGGTGGGGTAGGG + Intergenic
1175724537 20:61308867-61308889 CTGATCAAAGGGCTGGGCTATGG + Intronic
1175872335 20:62214401-62214423 CTGGACAAAGGCCTGGAGGGGGG - Intergenic
1176387632 21:6146802-6146824 CAGAACAAAAGGCTGAGGGAGGG - Intergenic
1178091909 21:29172840-29172862 GGGAACAAGGGGCGGGGGGAGGG - Intronic
1179073414 21:38094556-38094578 CTGAACAAAGGTAGGGGGCATGG + Intronic
1179305859 21:40153532-40153554 GTGATCACAGGGGTGGGGGACGG + Intronic
1179735840 21:43391446-43391468 CAGAACAAAAGGCTGAGGGAGGG + Intergenic
1180716458 22:17875859-17875881 CTGCAGGAAGGGCAGGGGGATGG + Intronic
1180800094 22:18627687-18627709 GTGCACAAGGGGCAGGGGGAGGG - Intergenic
1180816204 22:18791373-18791395 CTGCGCAAAGGTCTGGGGGCCGG - Intergenic
1181085708 22:20438413-20438435 CGGACCAGAGGCCTGGGGGAAGG + Intronic
1181202393 22:21225705-21225727 CTGCGCAAAGGTCTGGGGGCCGG - Intronic
1181221621 22:21367579-21367601 GTGCACAAGGGGCAGGGGGAGGG + Intergenic
1181699313 22:24610909-24610931 CTGCGCAAAGGTCTGGGGGCCGG + Intronic
1181824873 22:25507028-25507050 ATGAATAAAAGGATGGGGGATGG - Intergenic
1181971184 22:26691297-26691319 CTTAACAAGAGGCTGGAGGAAGG + Intergenic
1182524713 22:30907969-30907991 CTGCCCAAAGGGCTGGGGAGAGG + Intergenic
1183089224 22:35509880-35509902 CTGAAAAGATGGCAGGGGGAGGG - Intergenic
1183699047 22:39439559-39439581 CAGAAAGCAGGGCTGGGGGAAGG + Intergenic
1183970486 22:41473905-41473927 CTGAACAAGAGGCTGGGGCTAGG + Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184256205 22:43288521-43288543 CTGAACAAAGGGTGGGACGAAGG - Intronic
1184294051 22:43512707-43512729 AGGAACGAAGGGCTGGGGGGAGG - Intergenic
1185155089 22:49188694-49188716 TTAAACAAAGGGCTGGGAGCTGG - Intergenic
1185345971 22:50310967-50310989 GGGGACACAGGGCTGGGGGAGGG - Exonic
1203224520 22_KI270731v1_random:69708-69730 CTGCGCAAAGGTCTGGGGGCCGG + Intergenic
1203266307 22_KI270734v1_random:17084-17106 CTGCGCAAAGGTCTGGGGGCCGG - Intergenic
950076242 3:10189296-10189318 ATGTACAAAGGCCTGGGGGTGGG + Intronic
953025544 3:39142854-39142876 CTGAAGAGAGGACTGGGGGGAGG - Exonic
953143477 3:40250850-40250872 CTGCCCAAAGGGCAGGGAGATGG + Intronic
953329821 3:42043501-42043523 CTGCTCACAGGGCTGGGGGTAGG - Intronic
953404197 3:42652567-42652589 CTGCAGAAAGGGCTGGAGGTTGG - Intergenic
954111640 3:48436871-48436893 CAGAACATGGGGGTGGGGGACGG - Intronic
954271931 3:49516754-49516776 TTGAAGAAATGGCTGAGGGAGGG - Intronic
954290687 3:49648410-49648432 CTGACCATAGGGCTGGGGAAGGG + Intronic
954615190 3:51965909-51965931 CTGGAAGAAGGGCTGGGGGGTGG + Intronic
954618944 3:51984977-51984999 CTGGACACAGGGTTGGAGGAAGG - Intronic
955126538 3:56117836-56117858 CTCAACAACAGGCTGGAGGAAGG + Intronic
955389880 3:58513988-58514010 GGGAAAAAAGGTCTGGGGGAGGG + Intronic
955827940 3:62968335-62968357 CTAAACAAAGGGCAGAGGAAAGG - Intergenic
956155286 3:66289582-66289604 CTGAAAAAAGCAATGGGGGAAGG - Intronic
956227319 3:66974497-66974519 TTCAATACAGGGCTGGGGGAAGG + Intergenic
958020753 3:87992335-87992357 CTGAGCAAAAGGGAGGGGGAAGG + Exonic
959005912 3:101019731-101019753 CTGAACACAGGGCAAGGGGAGGG - Intergenic
959808870 3:110592698-110592720 CAGAGCAAAGGGCCGGGGGATGG - Intergenic
960114314 3:113878349-113878371 TTGATCCCAGGGCTGGGGGAGGG - Intronic
960673982 3:120177234-120177256 GGGAGCAGAGGGCTGGGGGATGG + Intronic
961001184 3:123375112-123375134 CTTGAAAAAGGGCTGGGGGCAGG - Intronic
961808201 3:129504308-129504330 CAAAGCAAAGGCCTGGGGGAAGG - Exonic
963102957 3:141623300-141623322 AGGGACAGAGGGCTGGGGGAAGG - Intergenic
963143938 3:141972659-141972681 CTGCAAAGAGGGCTGAGGGAGGG - Intronic
963598133 3:147354696-147354718 TTTAAGAAAGGGTTGGGGGAGGG - Intergenic
963874602 3:150461286-150461308 CTAAACAATCAGCTGGGGGAAGG - Exonic
966683595 3:182670103-182670125 CTGAACAAAGACCTGAGGAAGGG + Intergenic
967808801 3:193737748-193737770 CTGAACAAAGTGGGAGGGGAGGG - Intergenic
967893360 3:194378897-194378919 CTGAGCAAAGGCCTGGAGGCAGG + Intergenic
968086815 3:195877583-195877605 CTGAGCAACTGGCTGGGGCAGGG - Intronic
968284909 3:197502825-197502847 CTGAACAATGTCCTGGGGGATGG + Intergenic
968337843 3:197928979-197929001 CTGGCCACAGGGCTGGGGAAGGG - Intronic
968483990 4:849992-850014 CTGCACACAGTGCTGTGGGACGG - Exonic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
969538766 4:7772872-7772894 CTGAAGAAAGCGCTGGCGGGCGG - Exonic
970464702 4:16310877-16310899 CTTATAAAAGGGCTGGAGGAGGG + Intergenic
970531435 4:16989434-16989456 CTGATCAAGGGGGTTGGGGAGGG - Intergenic
972397805 4:38672571-38672593 ATGAACAAAGGCCTGGGGGTGGG + Intronic
972831616 4:42820520-42820542 ATGAAGCAAGGGATGGGGGAAGG - Intergenic
973247589 4:48025926-48025948 CTGAATGAAGGGCAGGGAGAAGG - Intronic
973251782 4:48068288-48068310 GTAAAGAAAGGGCTGGGAGAAGG + Intronic
975470060 4:74755716-74755738 CTAAACAAGTGGCTGGGGGCAGG + Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
978214063 4:106176322-106176344 AAGAAGAATGGGCTGGGGGATGG - Intronic
978728838 4:112001165-112001187 CTAAACATATGGCTGGGGGAAGG + Intergenic
980688377 4:136260210-136260232 CTGAAGAAAGGGGTGAGTGAAGG + Intergenic
980954450 4:139414238-139414260 CTGGACAAGGGTCTGGGGTAAGG + Intronic
982254660 4:153440282-153440304 CTGAATAAATGAGTGGGGGATGG + Intergenic
984118150 4:175708215-175708237 CTAAACAAAGAGGTGGGGTAAGG + Intronic
985081315 4:186267208-186267230 CTTAACTATGGGCTGGGAGAGGG + Intronic
986051435 5:4094103-4094125 CAGAATAGAGGGGTGGGGGAGGG + Intergenic
986624164 5:9707738-9707760 CAGAACAAAAGCTTGGGGGAGGG - Intronic
989492358 5:42073017-42073039 GCTAACAAAGAGCTGGGGGAAGG - Intergenic
990401067 5:55437994-55438016 CTAAACACAGGGCAGGGGCAAGG + Intronic
990582254 5:57175725-57175747 CCCAACAACGGGGTGGGGGAAGG - Intronic
991551416 5:67840930-67840952 TTGAAGAAATGGCTGGGGCAGGG - Intergenic
991936609 5:71808107-71808129 CTGAACAATGGGGTTGGGGGCGG + Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
992076458 5:73196941-73196963 CAGAGCAAAGGGCTGAGAGAAGG - Intergenic
992177793 5:74167439-74167461 CTGAATAAAAGGCTGAGGGTGGG + Intergenic
992583289 5:78204555-78204577 TGGAACAAAAGGCTGGAGGATGG - Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
992996577 5:82339833-82339855 CTGGACAAGGGCCTGGGAGACGG + Intronic
993350001 5:86838424-86838446 CTAAAAAAGGGGTTGGGGGAGGG - Intergenic
994472931 5:100232546-100232568 CTGACCATAGCACTGGGGGAAGG + Intergenic
994845023 5:104977623-104977645 TTGAACAAAGGACTGGGAGAAGG + Intergenic
997287230 5:132688915-132688937 CTCTAAAAAGGGATGGGGGAGGG + Intergenic
998245838 5:140504051-140504073 CTAAAAAAAAGGGTGGGGGAGGG - Intronic
998537210 5:142944931-142944953 CTGAGCAATGGGGTTGGGGAGGG - Intronic
998623763 5:143822991-143823013 ATGAGCAAAGGCCTGGAGGAGGG + Intergenic
999339676 5:150759188-150759210 CTCACAAAAGCGCTGGGGGACGG - Intergenic
999346814 5:150830101-150830123 CTGAAGAAAGGGCGGAGGAAGGG + Intergenic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000987462 5:167876272-167876294 CTGAAACAAGGGCTGGGGGAAGG + Intronic
1001318860 5:170663873-170663895 GTGTACACAGGGCTGGAGGAGGG - Intronic
1002536782 5:179880163-179880185 CTGCACAGAGGGCTGGGTGATGG + Intronic
1003287043 6:4743509-4743531 CTGAAGATGTGGCTGGGGGAAGG - Intronic
1003477565 6:6498202-6498224 TTTGACAAAGTGCTGGGGGAGGG + Intergenic
1003507489 6:6751712-6751734 AGGAACAAATTGCTGGGGGAGGG - Intergenic
1006782834 6:36643717-36643739 CTGAACGAGGGGGTGGGGGAGGG - Intergenic
1006915061 6:37588563-37588585 GTGAGCTGAGGGCTGGGGGATGG - Intergenic
1006950520 6:37818779-37818801 CCAGACAAGGGGCTGGGGGAGGG + Intergenic
1007345596 6:41227550-41227572 CTGAATAAAGAACTGGGGGGGGG - Intergenic
1007392535 6:41558349-41558371 CTGAACCAAGGGCTGGGAGAGGG + Intronic
1007634660 6:43291646-43291668 CTGAACCCAGGGCTGGGGAGGGG - Intergenic
1007816340 6:44528088-44528110 CAGGGCTAAGGGCTGGGGGAAGG - Intergenic
1008547475 6:52595989-52596011 CTGAACAGAGAGTTGGGGGATGG - Intergenic
1008565258 6:52761956-52761978 GTGAGCACAGGGCTGGGGGTAGG - Intronic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1014441231 6:121476366-121476388 CTGCAGAAAGGACTGAGGGAGGG - Intergenic
1014882587 6:126741923-126741945 CTGAACACAGGGCTGGGGACTGG + Intergenic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015708559 6:136114697-136114719 GGGAACACAGGGCTGGGGGTGGG - Intronic
1016093147 6:140003451-140003473 CAGAACAAAAGGCTGGGTAAGGG + Intergenic
1016100885 6:140098738-140098760 ATGTACAAAGTGCAGGGGGAAGG + Intergenic
1017117748 6:150995141-150995163 CTGGACTTAGGGATGGGGGAGGG + Intronic
1017488493 6:154923866-154923888 CTGAACAAAGGGAGGGGGAAGGG - Intronic
1017790122 6:157790549-157790571 CAGAAAACAGGGCTGGGGGTGGG - Intronic
1019101638 6:169635420-169635442 CTGAAGACAAGGCTGAGGGAGGG + Intronic
1019408364 7:895695-895717 CAGAACAAAGGAGTGGGAGAGGG - Exonic
1019866171 7:3712517-3712539 CAGACCAGAGGGTTGGGGGATGG - Intronic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1020261432 7:6532595-6532617 CTGAGGACAGGGCTTGGGGAGGG - Intronic
1020281712 7:6653337-6653359 CTGGGCAACGGCCTGGGGGAGGG + Exonic
1020738791 7:11986841-11986863 CTTAAAAAAAGGCTGGGGGTGGG + Intergenic
1021000418 7:15323683-15323705 CAGAGCAAAGGGCTATGGGATGG + Intronic
1022264420 7:28740055-28740077 CTGAAAAAAGGAATGGGGGTGGG + Intronic
1022666416 7:32415681-32415703 CAGAACAAAAGGCTGGCGGTGGG + Intergenic
1023345563 7:39267897-39267919 ATAGACAAAGGGCTTGGGGAGGG - Intronic
1023761376 7:43467999-43468021 CTGCACCCAGGGCTGGGGCATGG - Intronic
1023885435 7:44350495-44350517 CTGGCCAAAGGACTGGGGAAAGG + Intergenic
1023981049 7:45070255-45070277 CGGAACAAAGAGCTTGGAGAAGG + Intronic
1024531074 7:50393176-50393198 AGGAACATAGGGCTGGGGGCAGG + Intronic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026144502 7:67734820-67734842 CTGCACGTAGGACTGGGGGAAGG - Intergenic
1026503827 7:70965385-70965407 CTGAATACTGGGTTGGGGGAGGG - Intergenic
1027423658 7:78040976-78040998 TTCAACAAAGTGCTGGTGGAGGG - Intronic
1027766957 7:82356037-82356059 TTAAACAAAGGACTGGAGGAGGG - Intronic
1028573238 7:92315961-92315983 GTGATCAAAGGGATGGGGTAGGG + Intronic
1029612701 7:101635797-101635819 CTGACCCAAGCCCTGGGGGAGGG + Intergenic
1029710370 7:102295925-102295947 CTGAACAATGAGTTGGGGGCAGG - Intronic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1032263113 7:130352185-130352207 CTGATCACAGGGCAGAGGGAGGG - Intronic
1032542503 7:132715036-132715058 CAGGAGAAAGGGCTGGGGGTGGG - Intronic
1033339071 7:140478443-140478465 AGGAACATAGCGCTGGGGGAGGG + Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1034853386 7:154517088-154517110 ATGATCCAAGGGCTGGGAGATGG + Intronic
1035479049 7:159167416-159167438 CTGAGCAAGGGGCTTGGGAAGGG + Intergenic
1035489532 7:159260965-159260987 CAGAACAAAGGGCTGAGGAAGGG + Intergenic
1035564456 8:631855-631877 CTGAGCAAAGGCCTGGGGCGGGG - Intronic
1035716037 8:1755613-1755635 CTGCCCAGAGGGCTGGGGGTTGG + Intergenic
1036224400 8:6945467-6945489 GTGGACAAAGGGCTGAGGGGAGG - Intergenic
1036229011 8:6983769-6983791 GTGGACAAAGGGCTGAGGGGAGG - Intergenic
1036231464 8:7002874-7002896 GTGGACAAAGGGCTGAGGGGAGG - Intronic
1036233924 8:7021968-7021990 GTGGACAAAGGGCTGAGGGGAGG - Intergenic
1036236502 8:7043566-7043588 GTGGACAAAGGGCTGAGGGGAGG - Intergenic
1037698423 8:21249004-21249026 CTGACATAAGGGCTGGGGCAGGG - Intergenic
1037819069 8:22127104-22127126 CAGAACAGGGGGCTGGGGGTTGG - Exonic
1037987493 8:23299085-23299107 CTCAACAAAGTCCTTGGGGAGGG + Intronic
1038477917 8:27881491-27881513 CTAAACACAGGGGTGGGGGTGGG + Intronic
1039579330 8:38651047-38651069 CAGAACGAGGGGCTGCGGGACGG + Intergenic
1042577749 8:70239600-70239622 CTGAATCAAGTGCTGGGGGGCGG - Intronic
1043766856 8:84146368-84146390 CTGGACAGAGGGAGGGGGGAAGG + Intergenic
1043873331 8:85459523-85459545 CTAAAAAAAGATCTGGGGGAGGG - Intergenic
1044560443 8:93606803-93606825 CTGAACACAGGGATGGGAGGTGG + Intergenic
1044720243 8:95138356-95138378 CTGAAAAAGGGGCGGGGGGGGGG - Intronic
1045369255 8:101505186-101505208 ATGAAGAAAAGGATGGGGGAGGG - Intronic
1045394730 8:101749681-101749703 CTGAATAGAGGGTAGGGGGAAGG - Intronic
1045864420 8:106849125-106849147 GTGCACATAGGGCAGGGGGAAGG - Intergenic
1046531230 8:115448152-115448174 CTGAACAAAGATTTGGAGGATGG - Intronic
1047319349 8:123765023-123765045 CTGTGCAAAGGTCTGGGGAAAGG + Intergenic
1048722648 8:137344304-137344326 CTGAAGAAAGGGCTGGGTTTAGG + Intergenic
1049222449 8:141434234-141434256 CAGAACAAGGGGCTGGGGAATGG - Intergenic
1049532062 8:143159824-143159846 CTGGAGAAGGGGCTGGGGGTGGG - Intronic
1049805532 8:144537128-144537150 CTGAGCCAGGGCCTGGGGGAAGG + Intronic
1050363216 9:4850871-4850893 CTGAAGCAAGGGCTGGGAAACGG - Intronic
1050517621 9:6461387-6461409 CAGAACAAGGGGCGGGGGGGAGG - Intronic
1050555698 9:6788096-6788118 AGGAACAAAGGGCTGAAGGAGGG - Intronic
1050588752 9:7140949-7140971 CTAAACACAGGGCAGAGGGAAGG + Intergenic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1053131585 9:35618550-35618572 CAGAACACAGGGGTAGGGGATGG + Intronic
1053269486 9:36740269-36740291 CTGAAGCAAGGGCAGGGGGCAGG - Intergenic
1054456004 9:65430732-65430754 CTGACCACTGGGCTGTGGGAGGG + Intergenic
1054861456 9:69958089-69958111 GTGAACAGAGGGCTAGGGAATGG - Intergenic
1055951737 9:81735755-81735777 CAGAAGCAAGGGCTGGGGGTGGG + Intergenic
1056146227 9:83732208-83732230 TTTAACAAATGGCTGGGGTAGGG + Intergenic
1057454092 9:95191651-95191673 ATGAAAAAGGGGCTTGGGGATGG - Intronic
1057811060 9:98256803-98256825 CTGAACAAAGGGCAAGAGAAAGG - Intergenic
1057860534 9:98637303-98637325 CACAAGAAAGGGCTTGGGGAGGG - Intronic
1058153380 9:101486389-101486411 CGCAGCCAAGGGCTGGGGGAGGG - Intronic
1059754738 9:117281949-117281971 CTCAAGAAAGGGCTGGGAGTCGG - Intronic
1059902990 9:118949379-118949401 CTGAACTGAGGACTGGGGAATGG + Intergenic
1060218732 9:121753463-121753485 CTTGACCCAGGGCTGGGGGACGG + Intronic
1060584006 9:124774649-124774671 ATCAAGAAAGGGCTTGGGGAGGG + Intergenic
1060743262 9:126113393-126113415 CTGGACATGGGGCTGGGGAAAGG + Intergenic
1061227473 9:129289098-129289120 GTGACCACAGGGCTGGGGTAAGG - Intergenic
1061557874 9:131383044-131383066 ATGAACAAAGGCCTGGGGATGGG - Intergenic
1061950233 9:133931981-133932003 CTGAGCACAGGTCTGCGGGAGGG - Intronic
1062098924 9:134717896-134717918 CTCAACCCAGGGATGGGGGATGG + Intronic
1062374442 9:136255626-136255648 CTGAAGGAGGGGCTGGGGGCTGG + Intergenic
1062665203 9:137666970-137666992 TCGAACAAAAGGGTGGGGGATGG + Intronic
1186084683 X:5974147-5974169 CTGAATGAAGGGGTGGGGAATGG + Intronic
1186964603 X:14773598-14773620 CTAAACAAAGGCATGGAGGAGGG + Intergenic
1187187813 X:17003889-17003911 CTGAACAAAGTTCTGGAAGAAGG - Intronic
1187362459 X:18641325-18641347 ATGAACACAGGGATTGGGGAGGG - Exonic
1187398354 X:18937554-18937576 TTGAACCAAGGGAAGGGGGAGGG + Intronic
1187436279 X:19272986-19273008 ATGGACAAAGGGATAGGGGAAGG + Intergenic
1188491777 X:30745495-30745517 CTGAAGGAAGGGCTGGAGGCTGG - Intergenic
1189670632 X:43404680-43404702 CTGTGCAAAGGGCTGAGGAAGGG + Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190827705 X:54032704-54032726 CTGGACACCGGGGTGGGGGAGGG - Intronic
1192124438 X:68488754-68488776 CTCAAGAAAGCGATGGGGGAGGG + Intergenic
1192214722 X:69150337-69150359 CTGAGCAAGGGGTTTGGGGATGG + Intergenic
1192561849 X:72132430-72132452 CTGAAAAAAGGGGCTGGGGATGG - Intergenic
1193217976 X:78887024-78887046 CTGAAAAAAAGGTGGGGGGAGGG + Intergenic
1195274010 X:103261452-103261474 CTGATCAAAGGGCTGGGAAAAGG - Intergenic
1195615258 X:106906748-106906770 CATAACAAATGGCTGGAGGAAGG - Intronic
1197446256 X:126554151-126554173 TTGCAAAAAGGGATGGGGGAAGG - Intergenic
1197734370 X:129839868-129839890 TTGAAGATAGGGCTGGAGGAGGG - Intronic
1199169317 X:144717698-144717720 CAGAACATAGGGCTTGAGGAAGG + Intergenic
1199779415 X:151044535-151044557 CAGAACAATGTGCTGGGGCATGG + Intergenic
1200006901 X:153091989-153092011 TTGAACAAAGAGCAGGGGGCAGG - Intergenic
1200608689 Y:5297735-5297757 CACAACCAGGGGCTGGGGGAAGG + Intronic