ID: 1160789877

View in Genome Browser
Species Human (GRCh38)
Location 19:918438-918460
Sequence CTGGTCACTCGGACCAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160789870_1160789877 -8 Left 1160789870 19:918423-918445 CCCTGAGCCATCCTGCTGGTCAC 0: 1
1: 0
2: 0
3: 17
4: 181
Right 1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1160789856_1160789877 29 Left 1160789856 19:918386-918408 CCGAGGAGGCCAGGGGCGCTGGG 0: 1
1: 0
2: 1
3: 70
4: 580
Right 1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1160789871_1160789877 -9 Left 1160789871 19:918424-918446 CCTGAGCCATCCTGCTGGTCACT 0: 1
1: 0
2: 3
3: 12
4: 221
Right 1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1160789864_1160789877 20 Left 1160789864 19:918395-918417 CCAGGGGCGCTGGGGGAGGGGGG 0: 1
1: 1
2: 13
3: 184
4: 1351
Right 1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1160789854_1160789877 30 Left 1160789854 19:918385-918407 CCCGAGGAGGCCAGGGGCGCTGG 0: 1
1: 0
2: 4
3: 79
4: 590
Right 1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1160789869_1160789877 -5 Left 1160789869 19:918420-918442 CCTCCCTGAGCCATCCTGCTGGT 0: 1
1: 0
2: 1
3: 21
4: 250
Right 1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160789877 Original CRISPR CTGGTCACTCGGACCAAGGT GGG Intronic
903051545 1:20604808-20604830 CTGGTTACTCCAAACAAGGTGGG - Intronic
907909775 1:58815599-58815621 CTGATCACTCAGAACATGGTAGG + Intergenic
908126075 1:61031480-61031502 CTGGTCACTTGGAACAAAGAAGG - Intronic
915507906 1:156369059-156369081 CTGGACCCTCGGCCCAAGGTAGG - Intergenic
916019593 1:160780219-160780241 GTGGTCACTGGGACCTAGGAGGG - Intergenic
1072034955 10:91554984-91555006 CTGGGAACACGGACCAAGCTCGG + Intergenic
1072797068 10:98364324-98364346 CTGGGCACTCTGCCCAAGGCTGG - Intergenic
1076740212 10:132479149-132479171 GTGGTCACCCGGACCTAGGATGG - Intergenic
1077475761 11:2789686-2789708 CTGGGCACTGGGACCACCGTGGG + Intronic
1077872993 11:6279110-6279132 CAGGTCAATGGGACCAAGGAAGG + Intergenic
1078606357 11:12779492-12779514 CTGGTCAATGGGACCAATATTGG + Intronic
1084875761 11:72131569-72131591 CTGGTCACTTGGATGAAGGCTGG + Intronic
1089402240 11:118171052-118171074 CTGGTCACTCGGGCCAGGGGCGG - Intronic
1091756614 12:3056527-3056549 GTGGTCACTGGGACCACGGAAGG + Intergenic
1091813012 12:3415456-3415478 CTGGTCACTCAAACCAAGACAGG - Intronic
1103447639 12:121004559-121004581 CTGGTGACCTGGACCAAGGGAGG - Intronic
1120750405 14:88192244-88192266 GTGGTCACTCTGACCACGGTGGG - Exonic
1125613619 15:40990257-40990279 GTGGGGACTTGGACCAAGGTAGG - Intronic
1127287942 15:57546928-57546950 CAGGTCACTGGCCCCAAGGTTGG + Intronic
1131653815 15:94432445-94432467 CTGGTTACTTTGACCAATGTTGG + Intronic
1132221341 15:100107905-100107927 CTGGTGACTCGGGTCAAGCTGGG - Intronic
1135545688 16:23364640-23364662 CTGGTGACTTGGGCCAGGGTGGG + Intronic
1139207633 16:65044617-65044639 CTGCTCACTCGGACAAATGGGGG + Intronic
1143625744 17:8109415-8109437 CTGGGGACTCGGCCCAAGGAGGG + Intronic
1144750373 17:17644389-17644411 CTGGTCACTCAGAACCAGGCAGG + Intergenic
1147256442 17:39184955-39184977 CTGGGCTCTGGGACCAGGGTGGG - Intronic
1147537713 17:41331789-41331811 CTGGAGCCTGGGACCAAGGTAGG - Intergenic
1147704494 17:42416685-42416707 CTGGTCACTGGGTCCAAAGCAGG - Intronic
1152267938 17:79307001-79307023 CTTGGCACTCGGAGCAAGGAGGG + Intronic
1160789877 19:918438-918460 CTGGTCACTCGGACCAAGGTGGG + Intronic
1167295440 19:48646533-48646555 CTGCTCGCTGGGACCCAGGTTGG + Intergenic
928323452 2:30301901-30301923 CTGGCCTCTGGGACCAAGGAAGG + Intronic
932463785 2:71899958-71899980 CTGGGCACTGGGACCTAGGCAGG + Intergenic
934494858 2:94788141-94788163 CTGGTCACTCCCACCAAGGGGGG + Intergenic
937434188 2:121866769-121866791 CTGGCCACTTGGCTCAAGGTGGG + Intergenic
941406159 2:165091282-165091304 CGGATCACTCGGAACAAGGTAGG + Exonic
941428950 2:165388670-165388692 CGGATCACTCGGAACAGGGTAGG - Exonic
941479816 2:165992359-165992381 CGGATCACTCGGAACAGGGTAGG + Exonic
941495712 2:166199801-166199823 CGGATCACTCGGAACAGGGTAGG + Exonic
945100704 2:206259998-206260020 CTGGCCACTTGGAAAAAGGTAGG + Intergenic
1173866259 20:46314303-46314325 CAGGTCACTCGGCCCGGGGTGGG - Intergenic
1175306515 20:57979477-57979499 CTGGACACTGAGACCAAAGTGGG - Intergenic
1178764665 21:35438952-35438974 CTGGGACCTGGGACCAAGGTTGG + Intronic
1181082455 22:20424335-20424357 CTGGTCACGGGGAGGAAGGTTGG - Intergenic
1182095255 22:27621499-27621521 CAGGTCACTCGGACCCTGGCAGG + Intergenic
955767971 3:62364873-62364895 ATGGTCACTAGGACAAAGGAGGG + Intergenic
957136204 3:76292881-76292903 ATGGTCACTTGTAACAAGGTAGG - Intronic
960461447 3:117940816-117940838 CTGGTCACTGGGTCCACGTTTGG + Intergenic
963620871 3:147604362-147604384 CTGGGCACAAGAACCAAGGTTGG + Intergenic
968649175 4:1753641-1753663 CTGGGCACTGGGACCCAGGTGGG + Intergenic
983647314 4:170004861-170004883 CTGGTCAATCTGACCAGGATTGG + Intronic
987458778 5:18180759-18180781 CTGTTTACTCTGACCAAGATTGG + Intergenic
997298150 5:132782489-132782511 CTGGGCACTCGGGACAGGGTAGG + Intronic
997531002 5:134581262-134581284 CTGGTCACTACTACCAAGGCGGG - Exonic
1002457762 5:179355459-179355481 TTGGTCATTCAGACCAGGGTTGG - Intergenic
1004149569 6:13102910-13102932 CTGGCTTCTTGGACCAAGGTTGG - Intronic
1006150456 6:31984161-31984183 CTGGAGAGTCAGACCAAGGTAGG + Exonic
1006156757 6:32016899-32016921 CTGGAGAGTCAGACCAAGGTAGG + Exonic
1020182660 7:5934431-5934453 ATGGTGACTGGGACTAAGGTGGG - Intronic
1020300251 7:6790326-6790348 ATGGTGACTGGGACTAAGGTGGG + Intronic
1022002300 7:26237428-26237450 TTGGTCACACAGACCAAGGCTGG - Intergenic
1022468834 7:30669367-30669389 CTGGTCACTCTGATCAATGTGGG + Intronic
1022558239 7:31322480-31322502 CTGGTCACACAGACCTGGGTTGG + Intergenic
1035317622 7:158006702-158006724 CTTGTCACTCAGAGGAAGGTAGG + Intronic
1048027761 8:130602237-130602259 CTGGTCAGATGGACCAAGGAAGG - Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1189325183 X:40107380-40107402 CTGCTCTCTCGCTCCAAGGTTGG - Intronic
1190936851 X:55005634-55005656 ATGGTCACTTGGACTAGGGTGGG - Intronic
1195272568 X:103246456-103246478 TTGGTCACAGGGACCAAGGCTGG - Intergenic
1199690555 X:150306112-150306134 CTGGTCACTGTGAGCAATGTGGG + Intergenic
1200169341 X:154060986-154061008 CTGGACACCTGGACCAGGGTGGG + Intronic
1200233023 X:154454510-154454532 CTGGTGGCTTGGACCAGGGTGGG + Intergenic