ID: 1160789900

View in Genome Browser
Species Human (GRCh38)
Location 19:918518-918540
Sequence CGGTGGGGATGCGCGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160789900_1160789905 -8 Left 1160789900 19:918518-918540 CCAGCGCCCGCGCATCCCCACCG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1160789905 19:918533-918555 CCCCACCGCAGCCAACCTGGCGG 0: 1
1: 0
2: 2
3: 57
4: 291
1160789900_1160789909 -2 Left 1160789900 19:918518-918540 CCAGCGCCCGCGCATCCCCACCG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1160789909 19:918539-918561 CGCAGCCAACCTGGCGGCCACGG 0: 1
1: 0
2: 1
3: 4
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160789900 Original CRISPR CGGTGGGGATGCGCGGGCGC TGG (reversed) Intronic
900971198 1:5993171-5993193 CGGTGGGGCTGCGCAGAGGCCGG - Intronic
902213859 1:14922881-14922903 AGGTGAGGATGCGGGGGCGGGGG + Intronic
903044295 1:20553898-20553920 CGGCGGGGCTGCGCGGGCGGCGG - Exonic
904236728 1:29121717-29121739 CGGGCGGGGAGCGCGGGCGCCGG + Exonic
905478399 1:38244931-38244953 GGGTGGGCATGAGAGGGCGCAGG - Intergenic
906204148 1:43978428-43978450 AGGTGGGGAGGCACGGGTGCTGG + Intergenic
908401402 1:63775021-63775043 CGGTGGCGATGCGAGGCCGCCGG - Intronic
912551601 1:110488683-110488705 CTGTGGGGATGTGAGGGCCCGGG + Intergenic
913962822 1:143353131-143353153 TGGTGGAGATGCTTGGGCGCCGG + Intergenic
914001649 1:143699686-143699708 GGGTGGGGGTGCGGGTGCGCGGG - Intergenic
914057177 1:144178716-144178738 TGGTGGAGATGCTTGGGCGCCGG + Intergenic
914121969 1:144787650-144787672 TGGTGGAGATGCTTGGGCGCCGG - Intergenic
915572244 1:156751084-156751106 GCGTGGGGATCCGAGGGCGCCGG - Intronic
915589236 1:156861163-156861185 CGGTGGGGGGGCGCGGGGACAGG + Intronic
916651640 1:166839557-166839579 GGGTGGGGACGCGAGGGCTCCGG - Intronic
916899733 1:169207790-169207812 CGGTGGGGAAGGGAGGGTGCTGG + Intronic
917345271 1:174022449-174022471 CGGAGGGGAGGGGCGGGCGCGGG + Intergenic
921089556 1:211830407-211830429 CGGGGAGGAGGCGGGGGCGCGGG - Intronic
922315064 1:224434634-224434656 CGGGGCGGCTGCGGGGGCGCGGG + Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
1064249233 10:13694101-13694123 CGGTGAGCAGGCGCGGGCGAGGG - Intronic
1067669527 10:48306604-48306626 CGCTCGGGAGGCGCGGGGGCGGG + Intergenic
1071475120 10:86019231-86019253 CGCTGGGGATGCGGGTGTGCAGG - Intronic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076792921 10:132786252-132786274 CGGCGGGGGCGCGCGGGCGGGGG - Intergenic
1077016240 11:400241-400263 CGCTGGGGATGGGCGTGCGAGGG + Intronic
1077176973 11:1195459-1195481 CAGTGGGGAGGGGCGGGTGCCGG + Intronic
1077327317 11:1969393-1969415 GGGTGGGGCTGCCCGGGGGCTGG - Intronic
1081489850 11:43558746-43558768 CGCTGGGGGTGCGGGGGCGGAGG + Intronic
1083293285 11:61701521-61701543 TGGTGGGGATGTGTGCGCGCAGG + Intronic
1083842993 11:65315240-65315262 CGGTGGGGATGCTGGGCGGCGGG - Intronic
1084319191 11:68364029-68364051 GCGTGGGGGTGCGCGGGCGTGGG + Intronic
1084485107 11:69443568-69443590 CGGAGAGGAAGCGCGGGGGCGGG + Intergenic
1084526808 11:69703225-69703247 CGGGGCGGATGCGCCGGGGCGGG - Intronic
1085312704 11:75525706-75525728 CGGCGGGGAGGCGCGGCGGCCGG + Exonic
1089729599 11:120511938-120511960 CGGAGGGGACTCGGGGGCGCGGG - Intronic
1089943264 11:122441229-122441251 AGGTGGGGCAGCGCGGGGGCGGG + Intergenic
1202810299 11_KI270721v1_random:24573-24595 GGGTGGGGCTGCCCGGGGGCTGG - Intergenic
1091460927 12:643014-643036 TGGCAGGAATGCGCGGGCGCCGG - Intronic
1091689021 12:2583242-2583264 CGATAGGGACGCGCGGGAGCGGG + Intronic
1091793735 12:3285850-3285872 CAGTGGGGGTGAGCGGGCACAGG + Exonic
1091794730 12:3291584-3291606 TGGTGGGGAGGCGAGGGCACAGG - Intergenic
1092218860 12:6699996-6700018 GGGTGGGGATGCACAGGCGGAGG - Intronic
1092443217 12:8527713-8527735 GGGTGGGGGAGCGCGGGCGGAGG - Intergenic
1093958699 12:25250621-25250643 CGGGTGGGGGGCGCGGGCGCGGG - Intronic
1094564874 12:31590632-31590654 CTGTGGGGACGCGCGGGAGGCGG - Intronic
1095981811 12:47978480-47978502 CCGTGGGGATGCCAGGGAGCGGG - Intronic
1097245418 12:57605089-57605111 CGGTGGGGATCCGGGGGCTTTGG + Intronic
1100611551 12:96194965-96194987 GGGAGGGGAGCCGCGGGCGCAGG - Intronic
1102501941 12:113358927-113358949 GGAGGGGGATGCGTGGGCGCCGG + Intronic
1102505373 12:113381243-113381265 CGGTGGGGATGTGGGGGGGGCGG - Intronic
1102520100 12:113472507-113472529 GGGTGGGGAGGCGGGGGAGCAGG + Intergenic
1104941979 12:132399530-132399552 TGGTGGGGGTGCGTGGGGGCGGG - Intergenic
1105000597 12:132687658-132687680 CGCTGGGGAGGCGATGGCGCCGG + Exonic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1105472510 13:20705315-20705337 CGGTGGGGGTGGGGGGGCGTAGG + Intronic
1105578629 13:21674460-21674482 CGGAGCGGAGGCGGGGGCGCGGG - Intronic
1107359462 13:39603140-39603162 CTGTGGGCGCGCGCGGGCGCCGG + Exonic
1109506187 13:63306032-63306054 CGCTGGGGAGGCTCAGGCGCAGG - Intergenic
1116973557 14:51093670-51093692 CGGTGGGGTCGCGCGGACGGCGG - Intronic
1117978933 14:61322628-61322650 CGGTGGGTGTGTGCAGGCGCAGG + Intronic
1118220768 14:63853142-63853164 CGGTGGGTGAGCGCGGCCGCGGG + Exonic
1118299410 14:64601864-64601886 CGGCGGGGAGGCGAGAGCGCCGG + Intergenic
1122620818 14:103056912-103056934 GGGCGGGGATGGGCGGGCGTGGG + Intronic
1122620824 14:103056928-103056950 GCGTGGGGATGCGCGGGCTGGGG + Intronic
1122904328 14:104795127-104795149 CCGTGGGGCTCCCCGGGCGCTGG - Intronic
1122978569 14:105181101-105181123 CGCGGGGGACGCGGGGGCGCGGG + Intronic
1202853531 14_GL000225v1_random:36483-36505 TGGTGGCGATGCCCGGGCACGGG - Intergenic
1124239863 15:28020116-28020138 GGGTGGGGATGGGTGGGGGCGGG - Intronic
1125677861 15:41512081-41512103 CAGTGGGGATGGGGCGGCGCCGG - Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1128462921 15:67884795-67884817 CTGTGGGGAGGCGGGGGCGGCGG - Intergenic
1129006319 15:72376292-72376314 GGGTGGGGAGGCGAGGACGCAGG + Exonic
1129710953 15:77819993-77820015 CGGTGGGGAGGAAGGGGCGCGGG - Intronic
1129862394 15:78872788-78872810 CCCTGGGGCGGCGCGGGCGCAGG + Intronic
1132583296 16:694937-694959 CGGCGGGGAGGTGGGGGCGCGGG - Intronic
1132670593 16:1100789-1100811 AGGTGGGGAGGCGCGGGGGGAGG + Intergenic
1132915218 16:2340413-2340435 CGGAGGGGATGCGGGGTCGCGGG + Intronic
1135109435 16:19679145-19679167 GGGTGGGGAGGCGGGGGGGCGGG + Intronic
1136242104 16:28951022-28951044 CTGTGGGGAAGCGGGGCCGCTGG + Exonic
1136285321 16:29237216-29237238 CGGCGGGGAGGCGAGGCCGCGGG + Intergenic
1136285330 16:29237241-29237263 CGGCGGGGAGGCGAGGCCGCGGG + Intergenic
1136365241 16:29806548-29806570 CGGCCGGGGTGCGCGGGCGGCGG + Intronic
1136477986 16:30525287-30525309 CGGTGTGGATGCGCTGGTGCTGG + Exonic
1136518697 16:30782968-30782990 CGGTGTGGATGCGCTGGTGGCGG + Exonic
1136665803 16:31811278-31811300 CGGTGGGGAGGTGAGGTCGCAGG - Intergenic
1136709966 16:32228924-32228946 CGGGGGGCAGGGGCGGGCGCAGG + Intergenic
1136757943 16:32700487-32700509 CGGGGGGCAGGGGCGGGCGCAGG - Intergenic
1136810163 16:33169888-33169910 CGGGGGGCAGGGGCGGGCGCAGG + Intergenic
1136816639 16:33279968-33279990 CGGGGGGCAGGGGCGGGCGCAGG + Intronic
1138133893 16:54504776-54504798 CGGTGGGGGTGCATGGGGGCGGG + Intergenic
1139448730 16:67014245-67014267 CGGGGCGGACGTGCGGGCGCCGG + Intergenic
1139557108 16:67719253-67719275 TGGCGGGGATGCGCGGGCCCGGG + Exonic
1140393282 16:74606775-74606797 CGGCGGGGAGGAGCGGGGGCTGG - Exonic
1141610904 16:85180667-85180689 CAGTGGGGAAGTGCCGGCGCCGG + Intronic
1141694848 16:85614395-85614417 AGCTGGGGGTGGGCGGGCGCAGG - Intronic
1142136533 16:88454215-88454237 CGGTGGGGGTGGGCGCGGGCCGG - Intronic
1142267409 16:89070916-89070938 CGGTGGGGGGGCGAGGGCGGCGG - Intergenic
1142395220 16:89828250-89828272 GGCTGGGGACGCGGGGGCGCGGG - Intronic
1203060094 16_KI270728v1_random:960836-960858 CGGGGGGCAGGGGCGGGCGCAGG - Intergenic
1143116612 17:4584915-4584937 CGGTCGGGAACCCCGGGCGCGGG - Exonic
1143189543 17:5031692-5031714 CGGTGGGGGTGCGAGGCCGGGGG + Intergenic
1143487223 17:7261660-7261682 CGGCGGGGCTGGGCGGGAGCGGG - Intronic
1143625818 17:8109689-8109711 CGGTGAGGCTGCGGGGGCGGGGG + Intronic
1145031315 17:19507359-19507381 CGCGGGGGACGCGGGGGCGCGGG - Intronic
1147210420 17:38869918-38869940 ACGTGGGGCTGCGCGGGGGCGGG - Exonic
1147250833 17:39151666-39151688 CGGTGGGGGTGGGGGGGAGCTGG + Intronic
1147896553 17:43755317-43755339 CGGTGGGGAGGGGCGCGGGCGGG + Exonic
1148054814 17:44787659-44787681 CAGTGGGGCTGCGGAGGCGCTGG - Intergenic
1148607997 17:48944720-48944742 GGGTGGGGATGCACCGCCGCGGG - Exonic
1151453540 17:74213465-74213487 CGGCGGGGCGGGGCGGGCGCGGG + Intergenic
1151615160 17:75205380-75205402 CGGTGCGAATGCGCGTGCGTAGG - Intergenic
1151783787 17:76265440-76265462 ACGCGGGGCTGCGCGGGCGCGGG - Exonic
1152197380 17:78925500-78925522 CTGGGGGGAGGCGCGGGCGGAGG - Intergenic
1152863561 17:82709514-82709536 GGGTGGGGATGAGCAGGTGCGGG - Intergenic
1153040836 18:812082-812104 CGGTGGGGCCCCGCGGGCGGAGG - Intronic
1153329974 18:3863726-3863748 TGGTGGGGCTGAGCGGGCCCTGG - Intronic
1156275703 18:35581441-35581463 CGCGGGGGAGGCGGGGGCGCCGG - Intronic
1159040603 18:63320109-63320131 CGGCGCGGAGGGGCGGGCGCGGG + Exonic
1160024936 18:75209238-75209260 CGCGGGGGCTGCGCCGGCGCCGG - Exonic
1160232405 18:77058230-77058252 CGGTGGGGATGCGGGGATGCGGG + Intronic
1160686712 19:440185-440207 GGGAGGGGATGCGTGGGTGCCGG + Intronic
1160773512 19:844228-844250 CGGGGGAGAGGCGCGGGCGGGGG - Intronic
1160773530 19:844277-844299 CGGGGGAGAGGCGCGGGCGGGGG - Intronic
1160773537 19:844294-844316 CGGGGGAGAGGCGCGGGCGGGGG - Intronic
1160773598 19:844460-844482 CGGGGGAGAGGCGCGGGCGGGGG - Intronic
1160789900 19:918518-918540 CGGTGGGGATGCGCGGGCGCTGG - Intronic
1160839469 19:1139305-1139327 GGAAGGGGATGCGTGGGCGCCGG + Intronic
1161615370 19:5267198-5267220 CGGTGGTGATGTGGGGGCGGGGG + Intronic
1161963314 19:7534694-7534716 GGGTGGGGATGCGGGGTCACTGG - Intronic
1161988479 19:7670397-7670419 CGGAGGGGTTGCGGGGGAGCTGG + Exonic
1162315537 19:9936272-9936294 CGGCGGGCAGGTGCGGGCGCGGG - Intronic
1162728074 19:12701712-12701734 CTGAGGGCAGGCGCGGGCGCTGG - Intronic
1162778761 19:12995933-12995955 CGGAGGGGACGCGCGGCGGCCGG + Intronic
1165105823 19:33469238-33469260 CTGTGGGGATGGGTGGGCACAGG - Intronic
1165311256 19:35030599-35030621 CGGCGGGGATGCCCGGACGCCGG + Intergenic
1165940739 19:39413599-39413621 CGGAGGGGGTGCGAGGGCTCGGG + Intronic
1166719899 19:44990766-44990788 CGGTGGGGAAGGGCAGGGGCTGG + Intronic
1166861720 19:45815348-45815370 CCGTGGGGCTGCGCGGGATCGGG - Intergenic
1167074299 19:47239663-47239685 AGGAGGGGGGGCGCGGGCGCAGG - Intergenic
1167149864 19:47702318-47702340 CGGCGGGGATGCGGGGGTGCCGG - Exonic
1167473882 19:49689438-49689460 CGGCGGGGAAGCGCTGGCTCTGG - Exonic
1167708728 19:51097678-51097700 CGGGGGGGATGGGGGGGCGGGGG + Exonic
1167792097 19:51689285-51689307 CGGTGGGGAGGGGCCGGGGCGGG + Intergenic
1168687395 19:58357164-58357186 CGCTGTGGATGCGCTGGTGCTGG + Exonic
1168722567 19:58562248-58562270 CCGTGTGGATGCGCCGGTGCTGG + Exonic
1202696660 1_KI270712v1_random:131389-131411 TGGTGGAGATGCTTGGGCGCCGG + Intergenic
925298929 2:2796219-2796241 CGGTGGGGAGGCGCAGGGACGGG + Intergenic
925730594 2:6917507-6917529 CGTGCGGGCTGCGCGGGCGCGGG + Exonic
927055398 2:19361610-19361632 CGGGGCGGAACCGCGGGCGCCGG + Intergenic
927652435 2:24920441-24920463 CTGCGTGGAAGCGCGGGCGCGGG + Intergenic
927920846 2:26970907-26970929 CGGTCGGGATGCGGGAGTGCGGG - Intronic
927945780 2:27134407-27134429 CGGGCGGGATGGGCCGGCGCCGG - Exonic
930728732 2:54708596-54708618 CAGTGGGGAGGCGCAGGCGGTGG + Intergenic
931253835 2:60554069-60554091 GGCTGGGGAAGCGCGGGCGGAGG + Intergenic
931463406 2:62467195-62467217 GGGTGGGGAGGCGTGGGCGGGGG - Intergenic
931671648 2:64653575-64653597 TGGAGGGGATCCGCGGGCGCGGG - Intronic
932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG + Intronic
932728258 2:74198598-74198620 CGGGAGGGAAGCGCGCGCGCGGG - Exonic
933278228 2:80304637-80304659 CGGTGGGGAGGTGCGGACGGCGG + Exonic
935149108 2:100417666-100417688 CGGCGGGGACGCGCGCGGGCAGG - Intergenic
936038080 2:109128653-109128675 CGGGGAGGATGCCCGGGCGTCGG + Intergenic
936141826 2:109947730-109947752 GAGCGGGGATGCGCGGGCGTCGG - Intergenic
936178514 2:110245678-110245700 GAGCGGGGATGCGCGGGCGTCGG - Intergenic
936202864 2:110423754-110423776 GAGCGGGGATGCGCGGGCGTCGG + Exonic
937306017 2:120871349-120871371 CAGTGAGGATGCACGGGAGCTGG + Intronic
938274513 2:130006101-130006123 CGCTGGGGACGCGCGATCGCGGG - Intergenic
938368831 2:130756234-130756256 CGGTGGGTGGGTGCGGGCGCCGG + Intronic
938392411 2:130916238-130916260 AGGCGGGGACGCGGGGGCGCTGG - Intronic
938451573 2:131425432-131425454 CGGCGGCGAGGAGCGGGCGCGGG - Intergenic
944221757 2:197310535-197310557 CGGGCGGGACGCGCGGGCGCGGG - Intronic
944451684 2:199850675-199850697 GGGTGGGGAGGCGCGGGGGCGGG - Intronic
945404090 2:209424060-209424082 CGCTCGGGCTGCGCGGGCTCTGG + Intronic
947119536 2:226800175-226800197 CCGGGGGGAGGCGGGGGCGCCGG + Intergenic
948372026 2:237495640-237495662 CGGTGGGGAGGCTCTGACGCCGG - Intronic
948580795 2:238986244-238986266 CTGAGAGGATGCGCCGGCGCAGG - Intergenic
1168830249 20:841659-841681 AGGTGGGGATGCGCGCCCCCGGG + Intronic
1174295608 20:49543174-49543196 CGGTGGGGATGGGGGAGCGTGGG - Intronic
1174374675 20:50117999-50118021 CGGTGGGGATGGGTGGGCAGGGG + Intronic
1175147696 20:56909332-56909354 GGGTGGGCATGCACGGGGGCTGG + Intergenic
1175224875 20:57439217-57439239 GGGTGGGGGTGTGGGGGCGCAGG - Intergenic
1175890174 20:62312510-62312532 CGGTGGGGAAGAGCCGTCGCAGG + Exonic
1179944973 21:44666962-44666984 CTGTGGGGATGCCTGGGCCCAGG - Intronic
1181954632 22:26579425-26579447 CGGTGGGGAAGGGAGGGCCCTGG + Intronic
1182257787 22:29050653-29050675 TGATGGGGATGCGCTGGCTCAGG - Exonic
1183667549 22:39254296-39254318 GGGTGAGGATGCAGGGGCGCTGG - Intergenic
1184207599 22:43014951-43014973 CGGGCGGGACGCGGGGGCGCTGG - Intronic
1184265215 22:43342915-43342937 GGGAGGGGAAGCGCGAGCGCGGG - Intronic
1184697872 22:46150123-46150145 AGGCGGGGACGCGCGGCCGCGGG - Intergenic
1185296710 22:50058304-50058326 GCGTGGGGCTGCGCGGGCGGCGG + Intergenic
954437431 3:50503482-50503504 CGGCGGGGTTGGGGGGGCGCGGG + Intronic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
955018147 3:55091540-55091562 CGGAGGGGATGCACGAGAGCTGG - Intergenic
956358595 3:68420732-68420754 TTGTGGGGATTCGGGGGCGCAGG - Intronic
961305722 3:125958382-125958404 CGCTGCGCACGCGCGGGCGCCGG - Intergenic
961518856 3:127455597-127455619 CGGTCGGGATGGGCTGGAGCGGG + Intergenic
961574465 3:127823251-127823273 GGGTGGGGACGCGCGGGACCCGG + Intergenic
961789711 3:129366654-129366676 CGGTGGGGCAGCGAGGGCGCAGG + Intergenic
964041689 3:152268841-152268863 TGGTGGGGCTGGGCGGGCGGGGG + Exonic
964819668 3:160755885-160755907 CGGAGGGACCGCGCGGGCGCCGG + Intronic
966208453 3:177428208-177428230 CGGTGGGGATGGGCAGGGGCAGG + Intergenic
968674726 4:1871367-1871389 CGGGCGGGAGGCGCGGGGGCGGG + Intergenic
968701050 4:2058639-2058661 CGGGGCGCATGCGCGGCCGCGGG + Intergenic
968908018 4:3463452-3463474 GGGGGGGGGGGCGCGGGCGCGGG + Intronic
968965193 4:3766079-3766101 CGGAGGGAGCGCGCGGGCGCGGG + Intergenic
969436730 4:7193018-7193040 CGGAGTGGCTTCGCGGGCGCAGG + Exonic
969645793 4:8428199-8428221 CTGTGAGGATTCGCGGGCGGGGG - Intronic
979278188 4:118836182-118836204 CGGTGGCTGTGCGCGTGCGCAGG - Intronic
980930173 4:139177142-139177164 CGGTGGGGCGGCGCGGGCGGGGG - Exonic
983077476 4:163343867-163343889 CGGTGGGGAAGAGGGGGCGGGGG - Intronic
983940192 4:173529317-173529339 CGGCGGGGCTGCGCGCACGCTGG - Exonic
989103372 5:37839830-37839852 GGCTGGGGCTGCGCGGGCCCGGG + Intergenic
998377764 5:141702498-141702520 CGGTGGGGAAGGGTGGGCACGGG - Intergenic
1002079305 5:176728039-176728061 CGGTGGGGCTGTGCTGGGGCTGG + Intergenic
1003062832 6:2876089-2876111 CCGCGGGGCAGCGCGGGCGCGGG + Intergenic
1003325086 6:5085185-5085207 GGGCGGGGAGGCGCGGCCGCTGG - Exonic
1007781423 6:44257035-44257057 GGGAGGGGGTGCGCCGGCGCTGG + Intronic
1009905608 6:69867241-69867263 CTGGGGGGCGGCGCGGGCGCGGG + Intronic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1013576053 6:111483838-111483860 GGGTGGGGGCGCGCGGGCGCGGG + Intergenic
1016769452 6:147832541-147832563 GAGTGGGGATGCGCAGGCGATGG - Intergenic
1018613186 6:165662598-165662620 CGGAGGAGAGGGGCGGGCGCGGG + Intronic
1019267160 7:124342-124364 CGGTGGGAAGGGGCAGGCGCAGG + Intergenic
1019989600 7:4682429-4682451 GGCTGGGGCTGCGCGGGGGCCGG - Exonic
1022526039 7:31037966-31037988 CGGTGGGGTTGGGTGGGCGTGGG + Intergenic
1022814949 7:33905033-33905055 CGCTGGGGGCGCCCGGGCGCAGG - Exonic
1023842237 7:44104231-44104253 CGGAGGGGCTGCGGGGGGGCGGG - Intergenic
1026045457 7:66903234-66903256 CGGTCGGGGTGGGCGGGAGCTGG - Intergenic
1026941438 7:74289884-74289906 CGGTGGGCGTGGGCGGGAGCTGG + Intronic
1029448275 7:100626907-100626929 GGGTGGGGAGGCGCGGGCTGGGG + Intronic
1029460988 7:100693893-100693915 CGGCGGGGATGGGCCGGAGCGGG + Intergenic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1034200858 7:149282148-149282170 CGGTGTGGATGCGCTGGTGCCGG - Exonic
1034469858 7:151249237-151249259 CGGTGGGTGTGCCCGGGCGGCGG + Intronic
1036910812 8:12755528-12755550 CGGCGGGGCTGCGCGCGCCCGGG + Intronic
1036930603 8:12951956-12951978 CCGTGGGGGAGCGCGCGCGCGGG - Intronic
1037589805 8:20303357-20303379 AGGTGGGGACGCGAGGCCGCAGG - Intronic
1037901222 8:22690736-22690758 CCGTGTGGATGCGCAGGTGCCGG + Exonic
1038963602 8:32548409-32548431 CGATCGGGTTGCGAGGGCGCCGG + Intronic
1041689881 8:60678634-60678656 AGGTGGCGGCGCGCGGGCGCGGG + Intergenic
1045344305 8:101280769-101280791 GGGTGGAGATGCGCTGGAGCTGG + Intergenic
1049020140 8:139951032-139951054 CGGTGGGGATGTGCGCGCCTGGG - Intronic
1049396332 8:142402922-142402944 CGGTGGGGAGGGGAGGGGGCGGG - Intronic
1049694355 8:143976306-143976328 CGGAGGGGGTGGGCTGGCGCGGG + Intronic
1050304954 9:4298144-4298166 CGGCTGGGAAGCCCGGGCGCCGG + Intronic
1051896524 9:21994606-21994628 CCGTAGGGAGGCGCGCGCGCGGG + Intronic
1059483722 9:114611563-114611585 CGGTGAGTGTGCGCGGGCCCGGG + Exonic
1060404439 9:123366231-123366253 CGGTGCGACTGCGCGGGCACCGG + Exonic
1060481149 9:124017542-124017564 CGGACGGGGTGTGCGGGCGCGGG + Intronic
1060814121 9:126625909-126625931 CAGTGGGGAGCCGCGGGCGTCGG + Intronic
1060856024 9:126915252-126915274 CGGGGAAGAGGCGCGGGCGCGGG + Intronic
1061080173 9:128365190-128365212 GGCTGGGGAGGCGAGGGCGCGGG - Intergenic
1062032248 9:134366945-134366967 GGGTGGGGATGTGCAGGCCCGGG - Intronic
1185450011 X:276784-276806 CGGTGGGGATGTTGGGGCACTGG + Intronic
1186669954 X:11758193-11758215 CGGTGGGGGAGGGCGGGCGGGGG - Exonic
1186795669 X:13044505-13044527 CGGTGGGGATGCGGGGAAGGCGG - Intronic
1187403654 X:18984135-18984157 CGGCGGGGAGGCGCGGGGGCGGG + Exonic
1189915489 X:45851611-45851633 CGGCGGGGATGGGCGGGCAGGGG - Intergenic
1190265738 X:48826521-48826543 CCGTGGGGAGGCGGGCGCGCTGG - Intergenic