ID: 1160791020

View in Genome Browser
Species Human (GRCh38)
Location 19:923815-923837
Sequence TTCCCCCAAAGGGGCCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160791020_1160791034 28 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791034 19:923866-923888 TCCTCCTGGGAAACGGGTAGGGG No data
1160791020_1160791024 -4 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791024 19:923834-923856 GGAAGCTGCAGCCAGCTACCCGG No data
1160791020_1160791032 26 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791032 19:923864-923886 CTTCCTCCTGGGAAACGGGTAGG No data
1160791020_1160791030 21 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791030 19:923859-923881 CACAGCTTCCTCCTGGGAAACGG No data
1160791020_1160791029 15 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791029 19:923853-923875 CCGGATCACAGCTTCCTCCTGGG No data
1160791020_1160791033 27 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791033 19:923865-923887 TTCCTCCTGGGAAACGGGTAGGG No data
1160791020_1160791027 14 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791027 19:923852-923874 CCCGGATCACAGCTTCCTCCTGG No data
1160791020_1160791031 22 Left 1160791020 19:923815-923837 CCTGCGCGGCCCCTTTGGGGGAA No data
Right 1160791031 19:923860-923882 ACAGCTTCCTCCTGGGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160791020 Original CRISPR TTCCCCCAAAGGGGCCGCGC AGG (reversed) Intergenic
No off target data available for this crispr