ID: 1160792049

View in Genome Browser
Species Human (GRCh38)
Location 19:927490-927512
Sequence AAACCCAGCAGGGCTCGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 202}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160792032_1160792049 11 Left 1160792032 19:927456-927478 CCCCTCCCCCACCCGGCGACCCG 0: 1
1: 0
2: 0
3: 30
4: 454
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792043_1160792049 -1 Left 1160792043 19:927468-927490 CCGGCGACCCGGAAGGGTCATTA 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792033_1160792049 10 Left 1160792033 19:927457-927479 CCCTCCCCCACCCGGCGACCCGG 0: 1
1: 0
2: 1
3: 28
4: 332
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792041_1160792049 3 Left 1160792041 19:927464-927486 CCACCCGGCGACCCGGAAGGGTC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792035_1160792049 9 Left 1160792035 19:927458-927480 CCTCCCCCACCCGGCGACCCGGA 0: 1
1: 0
2: 1
3: 11
4: 285
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792038_1160792049 5 Left 1160792038 19:927462-927484 CCCCACCCGGCGACCCGGAAGGG 0: 1
1: 0
2: 1
3: 1
4: 69
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792040_1160792049 4 Left 1160792040 19:927463-927485 CCCACCCGGCGACCCGGAAGGGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792044_1160792049 -8 Left 1160792044 19:927475-927497 CCCGGAAGGGTCATTAAACCCAG 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792045_1160792049 -9 Left 1160792045 19:927476-927498 CCGGAAGGGTCATTAAACCCAGC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792042_1160792049 0 Left 1160792042 19:927467-927489 CCCGGCGACCCGGAAGGGTCATT 0: 1
1: 0
2: 0
3: 6
4: 24
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792036_1160792049 6 Left 1160792036 19:927461-927483 CCCCCACCCGGCGACCCGGAAGG No data
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202
1160792031_1160792049 17 Left 1160792031 19:927450-927472 CCTGCTCCCCTCCCCCACCCGGC 0: 1
1: 3
2: 27
3: 241
4: 2234
Right 1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG 0: 1
1: 0
2: 1
3: 9
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160792049 Original CRISPR AAACCCAGCAGGGCTCGGAG CGG Intronic
900373133 1:2341128-2341150 GGACACAGCAGGGCTGGGAGAGG - Intronic
900992368 1:6103971-6103993 AAACCCAGCTGGGCCTGGGGTGG - Exonic
901010633 1:6199754-6199776 AAACCCTCCAGGCCTGGGAGAGG - Intronic
901417179 1:9125367-9125389 TAACCCAACAGGGCCAGGAGTGG - Intronic
901706399 1:11076703-11076725 AAACCCAGCAGTGCTGGGAGAGG - Intronic
902556720 1:17251034-17251056 AAACCCCCCAGGGGTGGGAGTGG + Intronic
903326872 1:22573862-22573884 ACACCCAGGAGGGCTGGGAAGGG + Intronic
904584671 1:31573530-31573552 AAAGCCGGAAGGGCTCAGAGGGG + Intergenic
905003023 1:34688356-34688378 GAACCCAGCAGGGAGAGGAGAGG + Intergenic
905083784 1:35350655-35350677 AGGCCCAGCAGTGCTGGGAGTGG - Intronic
905883361 1:41478633-41478655 ACACCCAGCAAGGGTGGGAGTGG + Intergenic
906641771 1:47445208-47445230 TAACCCAGCAGGGAGTGGAGTGG - Intergenic
909391291 1:75125162-75125184 AAACCCACCAGGGCGAGGCGAGG + Intergenic
912937383 1:114015400-114015422 AAACCAGGCAGGGGTCGGGGTGG + Intergenic
915428791 1:155849253-155849275 AAAACCAGCAGGGCTGGGCACGG + Intronic
915526698 1:156480537-156480559 AACCCGAGCATGGCTCAGAGCGG + Intronic
916592152 1:166202763-166202785 GGAGCCAGCAGGGCTGGGAGTGG - Intergenic
918447747 1:184631883-184631905 AAAGCCACCAGAGCTCTGAGAGG - Intergenic
920108872 1:203573262-203573284 AAACCCAGCAGGGCCAGGCTTGG + Intergenic
922439988 1:225646934-225646956 AAACAAAGCAGGGCTGGGGGCGG + Intronic
922575179 1:226656321-226656343 AAACTCAGCAGGTGTGGGAGGGG + Intronic
923039317 1:230308581-230308603 GAACCCTGCAGGGCTAGGGGTGG + Intergenic
923261210 1:232269706-232269728 AGACCCAGCAGCACTGGGAGGGG - Intergenic
1062813496 10:482554-482576 AAAGCAAGCTGGGCTTGGAGAGG + Intronic
1063367973 10:5502775-5502797 AAACCCAGCAGGGAAGTGAGAGG + Intergenic
1064095956 10:12424651-12424673 AAACCCATCAGGGCTGGCTGTGG + Intronic
1066430696 10:35348658-35348680 AAGCCCGGCAGGGCCCTGAGAGG + Intronic
1070124944 10:73613594-73613616 AAACCCAAAAGGGCTGGGCGTGG + Intronic
1071294184 10:84207283-84207305 AAACCCAGGAGGGATCAGAGAGG + Intronic
1071467963 10:85958103-85958125 TGACCCAGCAGGGGTCAGAGGGG - Intronic
1072350748 10:94554859-94554881 AAACCCAAAAGGGCTGGGTGTGG + Intronic
1072628765 10:97131464-97131486 ATACCCAGCATGGCTGGCAGAGG - Intronic
1073375409 10:103029973-103029995 AAACCCAGCTGGTCTAGGTGAGG + Intronic
1074929180 10:118106198-118106220 AAACACAGGAGGACTCTGAGTGG + Intergenic
1077889046 11:6405561-6405583 AGACACAGCAGGGCTGGGAGTGG + Intronic
1078079016 11:8190667-8190689 AAATGCAGCAGGCCTAGGAGGGG - Intergenic
1080855718 11:36110002-36110024 AAGCCCAGCTGGGCTGAGAGAGG + Intronic
1081904739 11:46660998-46661020 AAACACAGAAGGGCTGGGTGTGG - Intronic
1083623523 11:64060375-64060397 AGACCCAGAAGGCCTCGGATTGG + Intronic
1085474485 11:76781378-76781400 AAGCCCAGCAGGCTTGGGAGGGG - Intergenic
1085523806 11:77153100-77153122 AAAGCCTGCATGGCTCCGAGTGG + Intronic
1087252132 11:95914387-95914409 AAAGCCTGCAGGGCAGGGAGTGG + Intronic
1089450435 11:118591679-118591701 AAACCCAGAAGGGCTGGGCATGG - Intronic
1089456015 11:118626212-118626234 AAAGCCTGCAGGGCTGGGTGAGG - Intronic
1091823455 12:3492579-3492601 AAGCCCAGCAGGGCTCTCTGCGG - Intronic
1092099225 12:5869512-5869534 TGACCCAGCAGGGGTTGGAGAGG - Intronic
1094189805 12:27686744-27686766 AAACCCAGCCTTGCTAGGAGCGG + Intronic
1101321413 12:103676345-103676367 AAACCAGGCAGGGCTGGGCGCGG - Intronic
1101681205 12:106967549-106967571 AAAACAATCAGGGCTGGGAGTGG - Intronic
1101733758 12:107447466-107447488 AAACCAGGCAGGGCTGGAAGGGG - Intronic
1101955073 12:109205777-109205799 AAAGCCTGCAGGGCTAGGGGTGG + Intronic
1101996526 12:109529347-109529369 ACACGCAGCTGGGCTAGGAGTGG - Intronic
1103564016 12:121806386-121806408 CAAGCCACCAGGGCTCAGAGAGG - Intronic
1103863779 12:124034994-124035016 AAAGGCAGGAGGGGTCGGAGGGG + Intronic
1104040734 12:125128654-125128676 AAATCCAGCTGTGCTAGGAGGGG + Intronic
1117413276 14:55469997-55470019 AAAACCAGTAGAGCTCGGGGGGG - Intergenic
1118914491 14:70091153-70091175 AAGCCCAGCATGGCACTGAGTGG + Intronic
1122092147 14:99347851-99347873 AAAGCCAGCAGGTCAGGGAGAGG + Intergenic
1124558474 15:30748846-30748868 AAAATCAGGAGGGCTCAGAGAGG + Intronic
1124672779 15:31656784-31656806 AAAATCAGGAGGGCTCAGAGAGG - Intronic
1125769119 15:42153438-42153460 GAACACAGCAGGGTTTGGAGTGG + Intronic
1126421054 15:48472512-48472534 AAGCCCAGCAAGGCTCCCAGTGG + Intronic
1128157496 15:65401090-65401112 AAATTCAGCAGGGCTGGGACTGG + Intronic
1128568023 15:68714047-68714069 AAACCCAGCAGGCCTCCCCGTGG - Intronic
1129119921 15:73389953-73389975 AAACTCAACAGGGCTGGGAAGGG - Intergenic
1129256721 15:74337963-74337985 CAACCCAGCAGTGATCAGAGAGG - Exonic
1131278508 15:91002332-91002354 TAACCAAACAGGGCTGGGAGCGG + Intronic
1133099883 16:3472721-3472743 AAACCAACCAGGGCCAGGAGCGG - Intronic
1134044563 16:11091737-11091759 AAACACAGCAGGCCTCTGATAGG + Intronic
1134818983 16:17230238-17230260 AAACCCACCAGGGCTGCGAGAGG + Intronic
1135324590 16:21518445-21518467 AGACTCAGCAGGGCTCTGTGTGG - Intergenic
1135414757 16:22260563-22260585 GACCCCAGCAGGGGTAGGAGTGG + Intronic
1136336077 16:29611715-29611737 AGACTCAGCAGGGCTCTGTGTGG - Intergenic
1139572451 16:67821639-67821661 AGACCCAGGAGAGCTGGGAGAGG - Intronic
1139703976 16:68727616-68727638 AAAACAAACAGGGCTCGGTGCGG + Intergenic
1141649334 16:85384850-85384872 AAGCCCAGCAAGACTCGGACAGG - Intergenic
1142036798 16:87867491-87867513 AGACTCAGCAGGGCTCTGTGTGG - Intronic
1142126336 16:88412392-88412414 TCACACAGCAGGGCTCAGAGAGG - Intergenic
1143121140 17:4607627-4607649 TAACACAGCTGGGCTCGAAGGGG - Exonic
1143275491 17:5706679-5706701 AAACCCATCTGGGGTGGGAGAGG + Intergenic
1143840675 17:9728841-9728863 AAAGCCAGCAGGGCCCCGAGAGG + Exonic
1145013685 17:19383701-19383723 AATCTCTGCAGGGCTGGGAGTGG - Exonic
1146902043 17:36594943-36594965 AAACCCAACAGGGGTCTGACTGG - Intronic
1147264099 17:39224854-39224876 GAGCCCAACAGGGCTAGGAGCGG + Intronic
1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG + Intronic
1148811463 17:50295153-50295175 AAACACAGCAGAGCTTTGAGGGG - Intergenic
1150142088 17:62738814-62738836 AAACCCAGGAGGGGCCTGAGAGG - Intronic
1155621431 18:27784842-27784864 AAGCATAGCAGGGCTAGGAGGGG + Intergenic
1156457096 18:37300955-37300977 TAAGGCAGCAGGGCTGGGAGTGG + Intronic
1159985036 18:74831808-74831830 ACACACAGCAGGGGTGGGAGTGG - Intronic
1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG + Intronic
1162394633 19:10409820-10409842 AACACAAGCAGGGCTGGGAGCGG + Intronic
1163231116 19:16002996-16003018 CAACCCAGAAGGGCTGGGGGTGG - Intergenic
1163248831 19:16113809-16113831 AAAGACAGCAGGGCTCAGAGAGG - Intronic
1165354984 19:35299103-35299125 AAACCAAGCAGGCATGGGAGAGG + Intronic
1165829878 19:38725219-38725241 AAACCCAGCAAGCCTGAGAGGGG + Intronic
1165938984 19:39405845-39405867 AGAGCCAGCAGGCCTTGGAGGGG - Intergenic
1165939790 19:39409494-39409516 AAGCGCCGCGGGGCTCGGAGAGG - Intergenic
1167128120 19:47565611-47565633 AAACCCAAAAGGGCCCAGAGTGG + Intergenic
1167272045 19:48511363-48511385 CAGCCCAGCAGGGCCCGGAGCGG - Intronic
1168712984 19:58512296-58512318 GTACCCAGCAGGGATGGGAGGGG - Intronic
925051833 2:821636-821658 AAAGCCAGCATGGCACGGGGAGG + Intergenic
925065189 2:924077-924099 AAACGCAACAGAGCTCAGAGAGG + Intergenic
925563754 2:5227045-5227067 GATCTCAGCAGGGCTGGGAGCGG - Intergenic
926225494 2:10964288-10964310 CAACCCAGCAGAGCGGGGAGTGG - Intergenic
926310020 2:11668607-11668629 AGGCCCAGCAGGGCCTGGAGGGG + Intronic
930029927 2:47052169-47052191 AAACCCTGGAGAGCTCAGAGAGG + Intronic
930624278 2:53679249-53679271 AAACCCTGCAGGTCTGGTAGAGG - Intronic
932189662 2:69730209-69730231 AAACCCAGGAGGGCTGGGCATGG + Intronic
932568550 2:72924581-72924603 GAACCCAGCAGGGCTGGGCTGGG - Intronic
939585892 2:144005138-144005160 AAAACAAGCAGGGTTAGGAGGGG - Intronic
942705519 2:178767295-178767317 GAACCCAGCACGGCTTGGACAGG + Intronic
944877749 2:203980164-203980186 AAATTCAGCAGGGCGCTGAGGGG + Intergenic
948751062 2:240133527-240133549 AAACACAGGTGGGCTGGGAGAGG + Intronic
948923785 2:241081310-241081332 AAAGCCAGCAAGGGTCGGGGTGG + Intronic
1170066424 20:12315670-12315692 ATCCACAGCAGGGCTGGGAGAGG - Intergenic
1170962441 20:21037387-21037409 GAACCCTGCAGGGCCAGGAGGGG + Intergenic
1172137517 20:32697275-32697297 AACCCAAGCAGGGCTGGGTGTGG + Intergenic
1172529243 20:35618787-35618809 AAATCCCGCAGGGCTCTGGGCGG - Intronic
1174398827 20:50264885-50264907 AAACCCAGCAGGGCCCACTGGGG - Intergenic
1174493674 20:50922870-50922892 AAACCCAGGAGGGCCAGGCGCGG - Intronic
1178040887 21:28639931-28639953 GAAACCAGCAGGGATCTGAGGGG + Intergenic
1178479261 21:32965207-32965229 AAACCCAGCAGAGCATGGGGAGG + Intergenic
1179609024 21:42537096-42537118 CCACCCACCAGGGCTCTGAGCGG - Intronic
1181045964 22:20214373-20214395 AAACCCACCTGGGCTAAGAGAGG - Intergenic
1181467994 22:23120605-23120627 TGACCCATCAGGGCTCAGAGAGG + Intronic
1182881572 22:33738414-33738436 AAAGCCAGCAGGGCACTCAGGGG + Intronic
1183962224 22:41418338-41418360 AGAGACAGCAGGGCTTGGAGTGG - Intergenic
1184117899 22:42432590-42432612 AAGCCCACCAGGGGTTGGAGTGG - Intergenic
1184784855 22:46666725-46666747 ACGCCCAGCTGGGCTTGGAGGGG - Intronic
950565672 3:13768296-13768318 AACCCCAGCTGGGCTGGGGGAGG + Intergenic
950653398 3:14421964-14421986 GGACCCAGCAGGGGTCGGAGGGG + Intronic
954164491 3:48745323-48745345 AAACCCAGCAGAGCTGGGTATGG - Intronic
954236479 3:49260916-49260938 AAACCCAGCAGGGAAAGCAGTGG - Intergenic
954613025 3:51956172-51956194 AAGGCCAGCAGGGCCCAGAGCGG - Exonic
954676752 3:52320136-52320158 CAACAGAGCAGGGCTTGGAGAGG - Intronic
956128361 3:66032508-66032530 AGACCCAGCAGGGCCAGGCGTGG - Intronic
956402663 3:68896752-68896774 ATACCCAGCAGGGATGTGAGAGG - Intronic
958675232 3:97261160-97261182 AAACAAAGCAGGGCTGGGGGTGG + Intronic
961856493 3:129876662-129876684 AAACCCTGAAGGGCTGGGCGCGG + Intronic
964140844 3:153397155-153397177 AACCCCAGTAGGGCTCTCAGTGG + Intergenic
964756555 3:160094719-160094741 AAGGCCAGTAGGGCTGGGAGAGG - Intergenic
968443713 4:637509-637531 AAACCAAGCCAGGCTCGGTGCGG - Intronic
969110276 4:4840060-4840082 ATACCCAGCAGAGCAGGGAGGGG + Intergenic
969465726 4:7355262-7355284 AAACCCGGAAGGGCACAGAGGGG - Intronic
971907332 4:32743310-32743332 AAACCCAGCATTGCTGGGTGCGG - Intergenic
972710167 4:41587619-41587641 TAACCCAGCAGGGCACAGGGTGG - Intronic
976812048 4:89108678-89108700 AAGCCCAGCTGGGGTCTGAGGGG - Intronic
977596813 4:98892054-98892076 AAACACAGCAGAGCTGGGCGCGG + Intronic
980190747 4:129521490-129521512 AAATCCATCAGGGCTCTGTGTGG + Intergenic
985771494 5:1814717-1814739 AAACCGAGAAGGGCCCAGAGAGG - Intronic
986206716 5:5631405-5631427 TTAACCAGCAGGGCTCAGAGAGG - Intergenic
997230632 5:132239786-132239808 AAACACAGCAAGGCCCAGAGAGG - Intronic
999198777 5:149801497-149801519 GAAGCCAGCAGGACTCAGAGTGG + Intronic
1000244983 5:159441765-159441787 AAAGCCAGCAGGACAGGGAGGGG + Intergenic
1000840140 5:166208153-166208175 AAACTCAGAAGGGTTGGGAGTGG - Intergenic
1000851141 5:166341377-166341399 AAGCCCAGCAGGTATGGGAGAGG + Intergenic
1001725087 5:173889843-173889865 AAAAGCAGCAGGGCTGGGGGTGG - Exonic
1002303967 5:178272755-178272777 ACACCCAGCAGGGCTTGGGTCGG - Intronic
1002374914 5:178781862-178781884 AAACCCAGCTGTGCTAGGAAGGG - Intergenic
1002586566 5:180252510-180252532 ACACCCTGCAGGGCCCGGGGTGG - Intronic
1004076490 6:12348593-12348615 AAAACAAGCAGGGCTGGGTGTGG - Intergenic
1004098436 6:12583178-12583200 AAAACAAGCAGGGCTCAGAAAGG - Intergenic
1006132440 6:31877609-31877631 AACCCCAGCAGGGCCTGGGGAGG + Intronic
1006509923 6:34516141-34516163 AGACCCAGCTGGGCTCTCAGGGG - Intronic
1006619999 6:35357214-35357236 GAACCCATCTGGGCTTGGAGAGG - Intronic
1006903592 6:37518362-37518384 GTGCCCAGCAGGGCTAGGAGTGG - Intergenic
1007774824 6:44219279-44219301 AAGCCCCGCAGGGCTGGGGGTGG - Intergenic
1009465582 6:63964595-63964617 AAACACAGCAGGACCCAGAGAGG + Intronic
1010089648 6:71965595-71965617 AAACCCAGCAGCGCTGAGGGCGG + Intronic
1011280003 6:85667447-85667469 AAAACCAGCACGGCAGGGAGTGG - Intergenic
1014740199 6:125140455-125140477 AAAACCATCAGGGCTGGGCGTGG - Intronic
1015868524 6:137752354-137752376 AAACCCAGCTAGTCTCGCAGTGG - Intergenic
1018368330 6:163144970-163144992 AACATCAGCAGGGCTCAGAGGGG - Intronic
1020926680 7:14336463-14336485 AAAAACAGCAGAGCTCAGAGAGG - Intronic
1022629103 7:32068954-32068976 CAACGCAGCAGCTCTCGGAGTGG - Intronic
1024873454 7:53993098-53993120 AAACCTAACAGGGCTTGAAGAGG - Intergenic
1024995195 7:55268802-55268824 TAACAGAGCAGGGGTCGGAGAGG + Intergenic
1026250983 7:68670478-68670500 AAAGCCAACAGGGCTGGGTGCGG + Intergenic
1026327030 7:69319397-69319419 AAAGCAAGCAGGGCTCAGAGAGG + Intergenic
1026560435 7:71444105-71444127 AATGCCAGCAGGGCAAGGAGTGG - Intronic
1027375215 7:77541240-77541262 AAAATCAGCAGGGCTTGGTGGGG - Intronic
1029382149 7:100221279-100221301 ACACCCAGGAGGCCTGGGAGGGG - Exonic
1032277829 7:130475261-130475283 AAACCAAGGAGGGCTGGGCGCGG - Intergenic
1033131838 7:138751512-138751534 AAACCAAGCAGGGGACGGCGAGG - Intronic
1034430056 7:151036691-151036713 TAACCCAGCAGGGCTCTGGAGGG - Intronic
1034469690 7:151248647-151248669 GAGCCCAGCAGGACTCAGAGGGG - Exonic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038643845 8:29348115-29348137 GAACACAGCAGGGCTGGGACTGG - Intronic
1040392198 8:46959812-46959834 GAACCCAGCAGGGCTCAGCTGGG + Intergenic
1041612272 8:59864848-59864870 AAACACAGCAAGGCAAGGAGTGG - Intergenic
1044611672 8:94098083-94098105 AAACCCTCCAGGCCTCTGAGTGG + Intergenic
1046581242 8:116095117-116095139 AAACCAAGCAGTGCTTGGTGGGG - Intergenic
1048637907 8:136318861-136318883 AAACCCTGCTTGGCTGGGAGTGG - Intergenic
1049051357 8:140199208-140199230 AAACTCAGGAGGTCTGGGAGGGG + Intronic
1049427202 8:142542777-142542799 ACACCCAGCAGGGCCAGGGGTGG - Intronic
1055637376 9:78292292-78292314 AGAGCCAGCGGGGCTGGGAGTGG + Intergenic
1059111937 9:111565919-111565941 AAACCCACTAGGGCTGGGCGCGG + Intronic
1061060869 9:128250034-128250056 AGTCCCAGCAGGGCCCGGTGGGG + Intronic
1061086998 9:128405220-128405242 ACGGCCAGCAGGGCCCGGAGTGG - Intergenic
1061362126 9:130150328-130150350 AAACCCAGCAGCCCTTGGGGCGG - Intergenic
1061416840 9:130451673-130451695 GCAGCCAGCAGGGCTCAGAGAGG - Exonic
1061880646 9:133567212-133567234 AGACCCAGAAGGTCTCTGAGGGG - Intronic
1062374554 9:136256051-136256073 AGACCCAGGAGGGCTCAGGGTGG + Intergenic
1062634407 9:137482680-137482702 ACACCCAGGAGGGCACGGACGGG + Intronic
1186190054 X:7059359-7059381 AAACCCAGCAAGGCCCTGAAAGG + Intronic
1187473521 X:19589827-19589849 AAACCCATCAGGGCTGGGCGCGG + Intronic
1189245124 X:39557488-39557510 AACCCCAGCAGGGCAAGGGGGGG + Intergenic
1191214524 X:57921229-57921251 AAAGCCAGCTGGGGTGGGAGGGG - Intergenic
1192258940 X:69492255-69492277 AAACCAAGGAAGGCTCTGAGAGG - Intergenic
1192523984 X:71825585-71825607 AAACCTAGGAGGGCATGGAGTGG + Intergenic
1194225385 X:91250318-91250340 AAACATAGCCGGGCACGGAGCGG - Intergenic
1201562239 Y:15330488-15330510 AAACCCAGCAAGGCCCTGAAAGG + Intergenic