ID: 1160792117

View in Genome Browser
Species Human (GRCh38)
Location 19:927703-927725
Sequence GGTGACCTCCAGCCTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 419}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160792098_1160792117 27 Left 1160792098 19:927653-927675 CCTGAGTCAGAAATGCCCCCTCA 0: 1
1: 0
2: 1
3: 17
4: 153
Right 1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG 0: 1
1: 0
2: 1
3: 45
4: 419
1160792102_1160792117 11 Left 1160792102 19:927669-927691 CCCCTCAGCACTTTCTTGGGTTG 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG 0: 1
1: 0
2: 1
3: 45
4: 419
1160792105_1160792117 9 Left 1160792105 19:927671-927693 CCTCAGCACTTTCTTGGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 190
Right 1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG 0: 1
1: 0
2: 1
3: 45
4: 419
1160792097_1160792117 28 Left 1160792097 19:927652-927674 CCCTGAGTCAGAAATGCCCCCTC 0: 1
1: 0
2: 1
3: 24
4: 186
Right 1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG 0: 1
1: 0
2: 1
3: 45
4: 419
1160792103_1160792117 10 Left 1160792103 19:927670-927692 CCCTCAGCACTTTCTTGGGTTGG 0: 1
1: 0
2: 1
3: 15
4: 188
Right 1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG 0: 1
1: 0
2: 1
3: 45
4: 419
1160792101_1160792117 12 Left 1160792101 19:927668-927690 CCCCCTCAGCACTTTCTTGGGTT 0: 1
1: 0
2: 1
3: 19
4: 193
Right 1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG 0: 1
1: 0
2: 1
3: 45
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160792117 Original CRISPR GGTGACCTCCAGCCTGGGGA TGG Intronic
900391793 1:2436851-2436873 GGGGACCTGCAGGCAGGGGAGGG + Intronic
900488099 1:2933071-2933093 GCTGAGCCCCAGGCTGGGGATGG + Intergenic
900640246 1:3685005-3685027 CGTGTCCTCCAATCTGGGGAGGG + Intronic
900784312 1:4638144-4638166 GATGACCTTCAGCCGGAGGAGGG - Intergenic
900974487 1:6008586-6008608 GCTGCACTCCAGCCTGGAGACGG + Intronic
901047886 1:6409565-6409587 ACTGCCCTCCAGCCTGGGCAAGG - Intergenic
901129238 1:6951794-6951816 GGTTAGCCCCAGCCTGGGAAAGG + Intronic
901626228 1:10626665-10626687 GGTGGCCTTCAGCCTGGGCGAGG + Intronic
901814261 1:11785029-11785051 GGTGGGCCCCAGCCTGGGGCTGG + Intronic
902726299 1:18338459-18338481 ATTGACCTCCAAACTGGGGAGGG - Intronic
902940687 1:19798733-19798755 CCTGCCCTTCAGCCTGGGGAGGG - Intronic
903140426 1:21335719-21335741 GCTGAGCTCCTGCCTGGGGTGGG + Intronic
903657100 1:24956195-24956217 CCTGAGCTCCAGCCTGGGAACGG - Intronic
903961230 1:27059064-27059086 GCTGAGCCCCAGCCTGGGGGAGG - Intergenic
905215188 1:36401683-36401705 GGTGGCCTGAAGCCTGGGGGTGG - Intergenic
905364088 1:37439348-37439370 GGTGGACTCCTGCCTGGGGTGGG - Intergenic
905365208 1:37447679-37447701 GCTGACCTCCAGCAGGGGCATGG - Intergenic
905592139 1:39173300-39173322 ACTGAACTCCAGCCTGGTGATGG + Intronic
906045622 1:42828786-42828808 GGTGAGCTCTAGGCTGGGCATGG - Intronic
906284093 1:44574746-44574768 CCTGACCTCCAGCCCGGGGTGGG + Intronic
906316144 1:44787454-44787476 GGTCAGCAGCAGCCTGGGGAAGG + Exonic
907350207 1:53823220-53823242 GCTGTTCTCCAGCCTGGGGATGG - Intronic
907373415 1:54017466-54017488 GGTGAGCTCCAGCCTCAGGGAGG + Intronic
907469674 1:54665180-54665202 AGTGACCTCATGCCTGGTGAAGG + Exonic
910470346 1:87546551-87546573 GGTTACCTCCAGTCCTGGGAAGG + Intergenic
912392031 1:109309879-109309901 GCTGTCCCACAGCCTGGGGAAGG + Exonic
912983616 1:114403406-114403428 ACTGCCCTCCAGCCTGGGCAAGG - Intronic
914690135 1:150018424-150018446 TGTGATCTGCAGCCCGGGGAAGG - Intergenic
915103416 1:153516447-153516469 GGAGACCTGGAGCCTGGAGAAGG - Intergenic
915332881 1:155124643-155124665 GGTGCCCTGCAGTTTGGGGAGGG - Intergenic
915499381 1:156304334-156304356 GCTGCACTCCAGCCTGGCGATGG + Intergenic
916681599 1:167109740-167109762 GTTGACCTCCAGCCAGGAGGTGG - Intronic
917692064 1:177479794-177479816 GGGGACGTCCAGGCTGGGAAAGG - Intergenic
917913600 1:179677826-179677848 GTTGACCTCCAGCCAGGAGGTGG + Intronic
917931189 1:179823945-179823967 GATGACCTCCTGGCTGGGCATGG - Intergenic
918742555 1:188153677-188153699 GGTGACCTTGAGGGTGGGGATGG - Intergenic
919481705 1:198098046-198098068 GCTGCATTCCAGCCTGGGGAGGG - Intergenic
920438149 1:205961451-205961473 GCTGACCTCCAGCCTGAGTGAGG - Intergenic
920989802 1:210925934-210925956 GTTGGCCTCCAGCCAGGAGATGG - Intronic
921131169 1:212221274-212221296 GCTGACCTCTAGCATAGGGAGGG + Intergenic
922725976 1:227923248-227923270 GTAGAGCCCCAGCCTGGGGAGGG - Intronic
923035021 1:230279686-230279708 GGGGCGCTCCGGCCTGGGGAAGG - Exonic
923606550 1:235448568-235448590 GGTAAGCTACTGCCTGGGGACGG + Intronic
923744216 1:236686160-236686182 GGTGATCGCGAGCCAGGGGAGGG - Intergenic
924323596 1:242873412-242873434 GCTGAGATCCACCCTGGGGAAGG - Intergenic
1062992279 10:1831373-1831395 TCTGACCTCCAGGCTGGGTAGGG + Intergenic
1064191269 10:13208052-13208074 GGTGACTTCCACCCTGAGAAGGG - Intronic
1064276756 10:13913491-13913513 CGTGGCCTGAAGCCTGGGGATGG - Intronic
1067040777 10:42952090-42952112 GGTGGCCACCAGCCAGGGGCGGG + Intergenic
1067278135 10:44852158-44852180 CGTGACCGCCAGCGTGGGGGAGG + Intergenic
1067308840 10:45093281-45093303 GCTGACCTGCAGCCTCGGGGGGG + Intergenic
1069707095 10:70465791-70465813 GCTGTCCTCCATCCTGAGGAGGG - Intergenic
1070848348 10:79542108-79542130 TCTGATCTCCAGCCTGGGGAGGG + Intergenic
1070925437 10:80218061-80218083 TCTGATCTCCAGCCTGGGGAGGG - Intergenic
1071526411 10:86362289-86362311 GGTGGGCTCCAGCCAGGGGAGGG - Intronic
1072588840 10:96808111-96808133 GGTCTCCTCCAGCCTGTGGCAGG - Intergenic
1073481519 10:103788950-103788972 GCTGAGGTCCAGCCTGGGGCGGG + Intronic
1074016163 10:109536345-109536367 GCACTCCTCCAGCCTGGGGATGG - Intergenic
1074037358 10:109753795-109753817 GTTGACCTCCAGCCAGGAGGTGG + Intergenic
1074354415 10:112769552-112769574 GGGGACCTCCAGCTTATGGAGGG - Intronic
1074825353 10:117210970-117210992 GGTGACTTACAGTTTGGGGAAGG - Intergenic
1075051297 10:119184109-119184131 GAGGCCCTCCAGCATGGGGAAGG - Intergenic
1075092353 10:119450922-119450944 GTTGGCGTGCAGCCTGGGGAGGG - Intronic
1075680094 10:124325429-124325451 GATGGCCTCAGGCCTGGGGATGG - Intergenic
1075856816 10:125636933-125636955 GGTGACCTGGGGCCTGGGGGAGG - Intronic
1076126636 10:127979162-127979184 GTTGTCCTCCAGCAAGGGGAAGG - Intronic
1076342911 10:129761843-129761865 AGTGACCTTCAGCCTGAGGAGGG + Intronic
1076427974 10:130380897-130380919 GGTGACCTTCAGCCGTGGGATGG - Intergenic
1076480689 10:130783469-130783491 TGTCACCCACAGCCTGGGGACGG - Intergenic
1076724219 10:132405830-132405852 GGTGACCTCTCGCCTGGCCACGG + Exonic
1076817441 10:132921810-132921832 CTTGACTTCCAGCCTGGGGCTGG + Intronic
1077046677 11:549776-549798 GGTGGCCTCTAGACTGAGGAAGG - Intronic
1077187606 11:1242418-1242440 GCTGACCTGCAGCCTGGAGACGG + Exonic
1077250760 11:1559620-1559642 GGTGATGTCATGCCTGGGGACGG - Intronic
1077439154 11:2560166-2560188 GGTGATGTCCATCCTGGGGAGGG + Intronic
1077439271 11:2560466-2560488 GGTGACGTCCATCCTGGGGGCGG + Intronic
1077471028 11:2760609-2760631 GGTGCCCTCCTGCCTGGGCTGGG - Intronic
1078575438 11:12498069-12498091 ACTGCCCTCCAGCCTGGGCAAGG - Intronic
1078588023 11:12610723-12610745 GCTGACCTCCAGCCAGGAGGTGG - Intergenic
1079970699 11:27031981-27032003 GGTAAGCTGCAGCATGGGGAGGG - Intergenic
1080923416 11:36731337-36731359 GATGGCCTCCAGCCAGGAGATGG - Intergenic
1081584781 11:44376806-44376828 GTAGACCTACAGGCTGGGGATGG - Intergenic
1081725793 11:45328230-45328252 AATGGCCTCCAGCCTGGGGAAGG + Intergenic
1081866209 11:46362000-46362022 GGTGAGTCTCAGCCTGGGGAAGG + Intronic
1082136893 11:48559314-48559336 GGTGACAGCCTGGCTGGGGAAGG - Intergenic
1083331259 11:61899412-61899434 GGGGACCCCCAGCGTGGGGCTGG - Intronic
1083431764 11:62616965-62616987 GGTGAGCACCAGGATGGGGATGG - Exonic
1083796696 11:65020990-65021012 GGTGGCCCACAGCCTGGGGAAGG + Intronic
1084475351 11:69385674-69385696 GCTGCCCTCCGGCATGGGGAAGG - Intergenic
1085035986 11:73300327-73300349 ACTGTACTCCAGCCTGGGGACGG + Intergenic
1085718978 11:78896770-78896792 GGAGCCAGCCAGCCTGGGGATGG + Intronic
1086124690 11:83338396-83338418 GGGGACTTCTAGACTGGGGAGGG + Intergenic
1086743371 11:90395633-90395655 GGTCACCTCCACTCTGAGGAAGG - Intergenic
1087484427 11:98744056-98744078 ACTGCACTCCAGCCTGGGGACGG - Intergenic
1088800059 11:113297193-113297215 GTTGACCTCCAGCCAGGAGGTGG - Intergenic
1089775352 11:120831909-120831931 GGTGTCATCCAGCATGCGGACGG - Exonic
1090556401 11:127881098-127881120 GGTTACCTCTAGATTGGGGAGGG - Intergenic
1090776223 11:129968444-129968466 GGTGAGTGCCAGTCTGGGGAGGG + Intronic
1091405599 12:207296-207318 GGTGCCCTGAAGCCTGGGGTTGG + Intronic
1091448359 12:557767-557789 GGGGACCACCAGCCAGGGGGTGG + Intronic
1091556509 12:1577568-1577590 TGTTTCCTCCAGCCTGGGGGCGG - Intronic
1092977924 12:13763711-13763733 GCTGACCTCCACCCTGTGGCAGG + Intronic
1096122557 12:49097654-49097676 AGTGACCTCCAGCTGGGGGTGGG - Exonic
1096502264 12:52071374-52071396 GGGGACCTTCAGCCTGTAGAAGG + Intronic
1096677503 12:53233539-53233561 GGTGTCCTCCCTCCTGGGAAAGG + Intergenic
1097184105 12:57187456-57187478 AGTGAGCTGCTGCCTGGGGATGG + Exonic
1100986114 12:100203158-100203180 GGTGAGCACCAGGGTGGGGAAGG - Intronic
1101004079 12:100384722-100384744 GCTGTCCTCCACCCTGAGGAGGG + Intronic
1101864140 12:108507506-108507528 ATTAACCCCCAGCCTGGGGATGG - Intergenic
1102666348 12:114577332-114577354 GCTGAGCTCCAGTCTGGGGCTGG - Intergenic
1102775674 12:115516435-115516457 GATGACCTTCTGCCTTGGGACGG + Intergenic
1103208724 12:119151072-119151094 GGTGAGCTCCGGGCTGTGGATGG - Exonic
1103363303 12:120366705-120366727 GGCGTCCTCCAGCCTGGGAAAGG - Intronic
1103559733 12:121787239-121787261 GGTGCCCTGCAGCCTTGGCAAGG + Intronic
1103728917 12:123013210-123013232 GGTGCCCACCAGCGTGGGGAAGG + Intronic
1103897936 12:124286304-124286326 GGGGACATCCAGTCTGGGGTGGG - Intronic
1104043493 12:125145609-125145631 GGAGGCCTCCAGCCTGGAGAAGG - Intergenic
1104273149 12:127300833-127300855 GGGTCCCACCAGCCTGGGGAGGG - Intergenic
1104948786 12:132429438-132429460 GGGAACTTCCAGCCTGGGGAGGG - Intergenic
1105038071 12:132940894-132940916 GGGGACCTCAAACGTGGGGAGGG - Intronic
1106421506 13:29589624-29589646 GGTGCCCTCCAGCGTTGGGGCGG + Intronic
1106489056 13:30200332-30200354 GGTGACATCCAGCCAGGGAGGGG + Intergenic
1107530301 13:41276734-41276756 AGAGACCTCCAGGCTGGGGGAGG + Intergenic
1107926616 13:45269380-45269402 GCCTACCCCCAGCCTGGGGAAGG - Intronic
1108738348 13:53308786-53308808 GGTGACCTCCACACTCAGGATGG - Intergenic
1109150683 13:58843747-58843769 GTTGCCCTCCAGCCAGGAGATGG - Intergenic
1110937987 13:81317096-81317118 GATGATCTCCAGCCTGAGCATGG + Intergenic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1111927121 13:94475984-94476006 GGTGAGCCACAGCCTGGAGATGG + Intronic
1114307449 14:21437022-21437044 GGTGCCCTCCAGGGTGGGGATGG + Intronic
1115441425 14:33440326-33440348 GGTGGTCTCAAGCCTGGTGAGGG + Intronic
1115647984 14:35383659-35383681 GGGGACCTGCAGGCTGAGGAGGG + Intergenic
1116063946 14:39958637-39958659 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
1116235889 14:42279185-42279207 AGTGAGCTCCAGGCTGGGGACGG - Intergenic
1116873900 14:50092660-50092682 TGTCACCACCAGCCTGGGCATGG + Intergenic
1119090048 14:71772957-71772979 GGTGGCCTCCAGGCTGAGGGTGG - Intergenic
1119423749 14:74523113-74523135 TATGACCTCCATCCTGGGTAGGG - Intronic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1120942010 14:89957868-89957890 GGAGACCTCCAGCCCTGGGCTGG + Intronic
1121450537 14:94004419-94004441 GCTGACCTCCAGCCAAGGCAAGG + Intergenic
1121792547 14:96709971-96709993 TGGGACCTGCAGGCTGGGGAAGG - Intergenic
1122308342 14:100779455-100779477 GGTAACCACCAGCCTCAGGAAGG - Intergenic
1122693862 14:103543572-103543594 GGTCACCTGGACCCTGGGGACGG - Intergenic
1122767247 14:104081124-104081146 GGTCACCTCCACCCTGAGGCTGG - Intergenic
1122775500 14:104115185-104115207 GGTTACCTCCAGCTGGGGAAGGG - Exonic
1122857325 14:104566081-104566103 GGTGCCCTCCAGCCTGAGGGTGG - Intronic
1122980073 14:105187516-105187538 GCTGCACTCCAGCCTGGGCAAGG - Intergenic
1124057223 15:26253447-26253469 AGTGCCCTCCAGCCTGGGCCTGG - Intergenic
1124368478 15:29090278-29090300 GGTGACCCCCTGCCTGGGATGGG + Intronic
1125458732 15:39887947-39887969 GCTGATCACCAGCCTGGAGAGGG + Intronic
1125722681 15:41852755-41852777 GGTGACGCCCAGCTTGGGGGGGG + Intronic
1125779492 15:42251962-42251984 GGTGGCAGCCAGGCTGGGGAAGG - Intronic
1125881800 15:43201872-43201894 TGTGATCTCCATCCTGGGAAGGG - Exonic
1127389992 15:58497658-58497680 GCTGACCTGGAGCCTGGGAAAGG - Intronic
1127786467 15:62359687-62359709 TGTGACCTCGAGACTGGGGAAGG + Intergenic
1129244735 15:74272295-74272317 GGAGACCTCCAGGATGAGGAGGG - Intronic
1129422986 15:75444401-75444423 ACTGCACTCCAGCCTGGGGATGG + Intronic
1130770756 15:86921249-86921271 GGTGAGTTCCAGCCTGTGGATGG + Intronic
1131254493 15:90853023-90853045 GGTGACCCGCAGGCTGGGGTGGG - Intergenic
1131330966 15:91498955-91498977 ATTCACTTCCAGCCTGGGGATGG + Intergenic
1131442907 15:92472197-92472219 GCTGACCCCCAGAGTGGGGAAGG + Exonic
1131682141 15:94734922-94734944 AATGACCTACAGCCTGGTGAAGG - Intergenic
1132890046 16:2199372-2199394 GGGTCCCTGCAGCCTGGGGATGG + Intergenic
1133036549 16:3036844-3036866 GGGCCCCTCGAGCCTGGGGAGGG - Intronic
1133222247 16:4323760-4323782 GGGAACCCCCAGCCTGGGGCCGG + Intronic
1134372640 16:13639467-13639489 ACTGAACTCCAGCCTGGAGACGG + Intergenic
1135271568 16:21074219-21074241 GATAACATGCAGCCTGGGGAAGG + Intronic
1135995173 16:27242591-27242613 GTAGACCTCCAGCCAGGGGAAGG - Intronic
1136236483 16:28916949-28916971 ACTGCACTCCAGCCTGGGGACGG + Intronic
1136268301 16:29133439-29133461 GGCCAGCTCCAGCCTGGGCACGG - Intergenic
1136714153 16:32263681-32263703 GGTGACTCCCAGCCTGGGCATGG + Intergenic
1136753746 16:32665737-32665759 GGTGACTCCCAGCCTGGGCATGG - Intergenic
1136784174 16:32925055-32925077 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1136814366 16:33204628-33204650 GGTGACTCCCAGCCTGGGCATGG + Intronic
1136820842 16:33314708-33314730 GGTGACTCCCAGCCTGGGCATGG + Intergenic
1136827405 16:33371247-33371269 GGTGACTCCCAGCCTGGGCATGG + Intergenic
1136832471 16:33470018-33470040 GGTGACTCCCAGCCTGGGCATGG + Intergenic
1136885610 16:33928751-33928773 GGTGAGGGGCAGCCTGGGGAGGG - Intergenic
1137716719 16:50602616-50602638 GGTGACTTCCAGAGAGGGGAGGG - Intronic
1138424946 16:56925384-56925406 ACTGAACTCCAGCCTGGTGATGG - Intergenic
1138482158 16:57310681-57310703 GGGGACCACAACCCTGGGGAGGG + Intergenic
1138519684 16:57563838-57563860 GCTGACCTCCTGCCTGCAGAGGG - Exonic
1138530429 16:57631563-57631585 GGCCACCCCCAGCATGGGGACGG - Intronic
1138955533 16:61966498-61966520 ACTGCCCTCCAGCCTGCGGACGG + Intronic
1139042061 16:63009882-63009904 ACTGCACTCCAGCCTGGGGATGG - Intergenic
1139373140 16:66480666-66480688 GGTGCCATCCAGCGTGGGGCAGG - Exonic
1139631972 16:68236499-68236521 GGTGACTTCCATACTGGAGAAGG - Exonic
1140990355 16:80205122-80205144 GCTGACCCCCTGCCAGGGGAAGG + Intergenic
1141536466 16:84684484-84684506 AATGACCCCCAGCCAGGGGAAGG - Intergenic
1141603029 16:85137639-85137661 TGTGACCTCCAGCTTCTGGACGG + Intergenic
1141626418 16:85263973-85263995 CGGGCCCTCCAGCCTGGGGCCGG + Intergenic
1141828690 16:86497788-86497810 TGGGACCTCCGGCCTGGGGTTGG + Intergenic
1141842334 16:86581056-86581078 GGTGACTGGCAGTCTGGGGAGGG + Exonic
1141855984 16:86681822-86681844 GGGGACTTCCAGGCTGGAGATGG - Intergenic
1142071609 16:88093773-88093795 GGCCAGCTCCAGCCTGGGCAGGG - Intronic
1142137504 16:88458405-88458427 GGTGACCTCCAGGGAGGGGCTGG - Intronic
1142140635 16:88471267-88471289 TGTGACCTCCACCCTCGCGAAGG + Intronic
1142220441 16:88851787-88851809 GGTGGCAGCCTGCCTGGGGAGGG + Intronic
1142247589 16:88976979-88977001 GGTGTCCTCTGCCCTGGGGAGGG + Exonic
1202992942 16_KI270728v1_random:27602-27624 GGTGACTCCCAGCCTGGGCATGG + Intergenic
1203055901 16_KI270728v1_random:926088-926110 GGTGTCTCCCAGCCTGGGCATGG - Intergenic
1203086829 16_KI270728v1_random:1189061-1189083 GGTGAGGGGCAGCCTGGGGAGGG + Intergenic
1142535558 17:615520-615542 GATGACGTACAGCCTAGGGAGGG + Intronic
1142717634 17:1755647-1755669 GGTGCCCGCCAGCCGGGGGCAGG + Intergenic
1144738767 17:17569532-17569554 GGTTTCCTCCAGCCTTGGGAGGG - Intronic
1147249408 17:39144111-39144133 GGAGGCCTGCAGCCCGGGGAAGG + Intronic
1147576955 17:41607907-41607929 TGTGATATCCAGTCTGGGGATGG + Intergenic
1148043975 17:44731044-44731066 GGTGGTCTCCAGCATAGGGAGGG + Intronic
1148110786 17:45143873-45143895 GGTGACCCAGAGACTGGGGAAGG - Exonic
1148155657 17:45424123-45424145 GGGGACCCCCAGCCAGGAGAGGG + Intronic
1149806016 17:59619256-59619278 GGTTTCCTACAGCCTAGGGAGGG - Intergenic
1149868266 17:60162366-60162388 GCAGACCCCCACCCTGGGGATGG + Intronic
1150387339 17:64772785-64772807 GGGGACCCCCAGCCAGGAGAAGG + Intergenic
1151654595 17:75490039-75490061 ACTGCCCTCCAGCCTGGCGACGG + Intronic
1152067349 17:78119034-78119056 GAGCACCCCCAGCCTGGGGAGGG + Exonic
1152637251 17:81435187-81435209 GGTGAGCTCAGGCCTGGGGGTGG + Intronic
1152637947 17:81437867-81437889 TGTGACCTCCAGCCAGGGTCGGG + Intronic
1153498192 18:5721620-5721642 GCTGACCCCCAGCCTGGGTTCGG + Intergenic
1154345004 18:13534844-13534866 GGTGGCCTGGAGCCTGGGGTCGG - Intronic
1156396946 18:36707328-36707350 TGGGAACTCCAGCCTGGGGCAGG - Intronic
1157520023 18:48339126-48339148 GCAGACCTCCAGGCTGGGGCAGG - Intronic
1159073242 18:63649166-63649188 ACTGCACTCCAGCCTGGGGACGG + Intronic
1160408925 18:78661543-78661565 AGTCAACTCCAGTCTGGGGATGG + Intergenic
1160562720 18:79769974-79769996 AGTGGCCGCCAGCTTGGGGATGG - Intergenic
1160563879 18:79775028-79775050 GGTGGGCTCCAGGGTGGGGAGGG + Intergenic
1160792117 19:927703-927725 GGTGACCTCCAGCCTGGGGATGG + Intronic
1160831193 19:1105561-1105583 GGTGGGCTCCAGCCTGGAGAGGG + Intronic
1161527243 19:4764022-4764044 CCTGACCTGCAGCCTGGGCAAGG - Intergenic
1161684890 19:5697828-5697850 GGTCACCTCTGGCCTTGGGAGGG - Intronic
1162636378 19:11970891-11970913 TTTGCCCTCCAGCCTGGGCAAGG + Intronic
1162771767 19:12953527-12953549 CTTGGCCTCCAGCCTGGAGAAGG + Exonic
1162806092 19:13138741-13138763 GGTGGCCTAGGGCCTGGGGAGGG - Exonic
1163055647 19:14715650-14715672 GGTGCTCAGCAGCCTGGGGAGGG - Intronic
1163102688 19:15107648-15107670 GGGTGCCTCCAGCCAGGGGAGGG + Intronic
1163779820 19:19240308-19240330 GCCCACCTCCAGGCTGGGGAAGG + Intronic
1163779871 19:19240473-19240495 GCCCACCTCCAGGCTGGGGAAGG + Intronic
1163950117 19:20576456-20576478 GTTGACCTCCAACCTGGAGGTGG + Intronic
1164869535 19:31631660-31631682 GGTGAAGGCCATCCTGGGGAGGG - Intergenic
1165102105 19:33444979-33445001 GGTGACCTCCAGCTTTCTGAAGG - Intronic
1165433609 19:35785290-35785312 GGTGCCCCCCAGCCAGGGCAGGG - Exonic
1166361870 19:42255832-42255854 GGACAGCTGCAGCCTGGGGACGG - Intergenic
1166796780 19:45430988-45431010 ACTGCACTCCAGCCTGGGGAAGG - Intronic
1166922697 19:46241229-46241251 ACTGAACTCCAGCCTGGGCAAGG + Intergenic
1167260738 19:48456254-48456276 GGGGATCCCCAGGCTGGGGAGGG + Exonic
1167296192 19:48651522-48651544 TGTGACAGCCAGCCTGGGGCTGG + Intergenic
1167669757 19:50843981-50844003 GTTGGCCTCCAGCCAGGAGACGG + Intergenic
925104952 2:1283217-1283239 GGTGACCACCAGCCTGGTGCAGG - Intronic
925142094 2:1557701-1557723 GCTGACCTCCACCCTGCAGACGG + Intergenic
925288588 2:2731392-2731414 GGAGTTCTCCAGGCTGGGGAAGG + Intergenic
925684585 2:6458409-6458431 GCTGGCCTCAAGGCTGGGGAAGG - Intergenic
925795626 2:7539443-7539465 GTTGGCCTCCAGCCAGGAGATGG + Intergenic
925877890 2:8328031-8328053 TCTGACCACCGGCCTGGGGAAGG + Intergenic
928169766 2:28995799-28995821 GGAGTCTTGCAGCCTGGGGATGG + Intronic
929006480 2:37398185-37398207 ACTGCACTCCAGCCTGGGGACGG + Intergenic
929197091 2:39196142-39196164 GTTGACCTCCAGCCAGGAGCTGG - Intronic
932111947 2:69010013-69010035 GGTGATGTTCAGCCTGTGGATGG - Intergenic
932405796 2:71512025-71512047 GGCAGCCTCCAACCTGGGGAGGG - Intronic
932788113 2:74626111-74626133 TGTGAACCCCAGCCTCGGGAAGG + Intronic
934681028 2:96284048-96284070 GGGGACCTCCAGGCAGAGGATGG - Intronic
937219939 2:120336955-120336977 GGTGTCCTGCAGCCAGGGGGTGG - Intergenic
937699395 2:124847045-124847067 GTTGGCCTCCAGCCAGGAGAGGG + Intronic
938184977 2:129223421-129223443 GGTTCCCTACTGCCTGGGGATGG + Intergenic
938262721 2:129906893-129906915 AGGAACCTCCACCCTGGGGATGG - Intergenic
940471141 2:154102275-154102297 GTTGACCTCCAGCCAGGCGGTGG - Intronic
940636137 2:156299407-156299429 GTTGACCTCCAGAATTGGGAAGG - Intergenic
940796768 2:158088954-158088976 GTTGGCCTCCAGCCAGGGGGTGG + Intronic
940971899 2:159904510-159904532 GCTGCCTTCCAGCCTGGGGCAGG - Intronic
941431240 2:165417162-165417184 GTTGACCTCCAGCCAGGAGGTGG + Intergenic
942190134 2:173461621-173461643 GGTGACTCTCATCCTGGGGAGGG + Intergenic
945974443 2:216259443-216259465 GGTGGCCGGCAGCCTGGGCAGGG + Exonic
946887359 2:224235776-224235798 ACTGCACTCCAGCCTGGGGAGGG - Intergenic
946901885 2:224380938-224380960 AGTGAACTCCATCCTGTGGAGGG - Intronic
947594210 2:231400556-231400578 GCTGACCTCCAGGGTGGGGAGGG + Exonic
947872135 2:233445101-233445123 GGTAGCCTCCAGACTGAGGATGG + Intronic
948860704 2:240751354-240751376 CATGACCTCCAGCATGGGAAAGG + Intronic
1168795161 20:606345-606367 GCTGACCTCCAGACTTGGGGTGG - Intronic
1170381932 20:15770704-15770726 GGTGACCTACAGCCTAAGGCAGG - Intronic
1170579456 20:17686928-17686950 GCTCACCTCCAGCCTGGGCTTGG + Intergenic
1170585036 20:17728161-17728183 GCTGAGCCCCAGCCTGGGGTGGG - Intronic
1171255394 20:23686153-23686175 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1171262737 20:23748075-23748097 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1171271874 20:23824279-23824301 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1171278165 20:23876094-23876116 GGTGGCCCCCACCCTGGGGGAGG - Exonic
1171278239 20:23876454-23876476 GGTGACTTGGAGCCTTGGGAGGG - Intronic
1172191749 20:33065909-33065931 GGTGTCTTCCAGCTGGGGGATGG + Intronic
1172223381 20:33288661-33288683 TGGGAGCTCCAGGCTGGGGAGGG - Intronic
1172867923 20:38113875-38113897 GCTGAGGTCCAGCATGGGGAAGG + Intronic
1174161578 20:48554676-48554698 AGAGACCACCAGCCTGGAGATGG + Intergenic
1174402224 20:50282252-50282274 GGTGTCCCCCAGCCAGGGGGCGG + Intergenic
1174404494 20:50294632-50294654 GGTGACCTCCAAGCTGTGGCTGG + Intergenic
1174662929 20:52230414-52230436 CCTGCCCTCCTGCCTGGGGATGG + Intergenic
1175321721 20:58092934-58092956 GGTGAGCATCGGCCTGGGGAAGG + Intergenic
1175577016 20:60067761-60067783 GGTGACCTCCAGCCTGCTTCAGG + Intronic
1175877117 20:62235605-62235627 GGTGACCTCCCCCATGGTGAGGG + Intronic
1175929838 20:62488579-62488601 GGTAAGCTCCAGGCTGGGGCAGG - Intergenic
1177653354 21:23985644-23985666 ACTGAACTCCAGCCTGGGCAAGG + Intergenic
1178038242 21:28609078-28609100 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
1178532540 21:33387482-33387504 AGTGACCTTCAGCCTGAGGCAGG + Intergenic
1178568853 21:33715878-33715900 ACTGCACTCCAGCCTGGGGACGG + Intronic
1179393150 21:41012153-41012175 GGAGCCCTCCAGCCCGGGGAGGG + Intergenic
1179437404 21:41371459-41371481 TCTGACCTCCAGCCTGGTGTGGG - Intronic
1179538546 21:42068352-42068374 GGGGACCACCTGCATGGGGAGGG - Intronic
1179665453 21:42908989-42909011 GGTGACTCCCGGCCTGAGGAGGG - Exonic
1180027807 21:45178301-45178323 GTTGGGCTCCAGCCTGGGGAGGG + Intronic
1180039880 21:45270421-45270443 GGTGGCCTCCAGCCAGGAGGTGG - Intronic
1181898090 22:26128940-26128962 GCTGACCTCCAGCATTGGGGGGG + Intergenic
1182987242 22:34731882-34731904 GGTGAGCTGCAGCCAGTGGAGGG + Intergenic
1183220071 22:36506683-36506705 AGTAACCTCCACCCTGGGGAAGG + Intronic
1183932786 22:41245817-41245839 GCTGTTCTCCAGTCTGGGGAGGG - Exonic
1184073629 22:42162414-42162436 GAAGCCCTCCAGCCTGGGGATGG - Intronic
1184515653 22:44960451-44960473 AGTGACTTCCAGCCAGTGGAGGG - Intronic
1184556515 22:45236139-45236161 GCTGAGCTTCAGCGTGGGGAGGG - Intronic
1184840243 22:47048333-47048355 GGTGGCATCCAGCCTGAGGTCGG + Intronic
1185409222 22:50673879-50673901 GGGGACCTCCAGACCGGGGAGGG - Intergenic
950108097 3:10401057-10401079 GGTGACCTCCTCCCTGCCGACGG - Exonic
952435507 3:33269253-33269275 GTTGACCTCCAGCCAGGAGGTGG + Intergenic
952993639 3:38855583-38855605 GTTGACCTCCAGCCAGGAGGTGG - Intronic
953276757 3:41508499-41508521 GTTGACCTCCAGCCAGGAGGTGG - Intronic
953382247 3:42480642-42480664 GTTGACCTCCAGCCAGGAGGTGG - Intergenic
953982523 3:47419790-47419812 AGGGACCTCAGGCCTGGGGATGG + Intronic
954194889 3:48990585-48990607 GATGCCCTCCAGCCGGGTGAGGG - Exonic
954278031 3:49554856-49554878 GGTGAGCTGCAGCCTGAGGCCGG + Intronic
954807193 3:53227359-53227381 GGTCTCCCCCTGCCTGGGGATGG + Intronic
955716461 3:61835369-61835391 ACTGCACTCCAGCCTGGGGAAGG - Intronic
956626871 3:71275258-71275280 GGTGTCCCTCATCCTGGGGATGG + Intronic
957110794 3:75954320-75954342 GGTTACCTCCAGCCAAGGGTGGG + Intronic
958131813 3:89436082-89436104 AGTGAGCTAAAGCCTGGGGATGG + Intronic
958513048 3:95073610-95073632 CTTGCACTCCAGCCTGGGGACGG + Intergenic
958775917 3:98482901-98482923 GTTGGCCTCCAGCCAGGAGATGG + Intergenic
960534866 3:118804379-118804401 AGATACCTACAGCCTGGGGAAGG + Intergenic
961087658 3:124082982-124083004 GTTGACCTCCTGCCTTGGGCAGG + Intronic
961467243 3:127089336-127089358 GGTCCCCTCCAGGCTGGGGAGGG - Intergenic
961581635 3:127888021-127888043 GGTGATGTCCAATCTGGGGAGGG + Intergenic
961643233 3:128378425-128378447 TGTGACCTCCCGCCTGGGACAGG + Intronic
962398898 3:135040431-135040453 GGGGACCTGCAGCATTGGGAGGG + Intronic
963522472 3:146372788-146372810 GTTAACCTCCAGCCTGGAGGTGG + Intergenic
964772509 3:160239229-160239251 GGTGGCCTGGAGCCTGGGGCGGG + Intronic
967958662 3:194900799-194900821 GCTGGCCTCCAGCCAGGAGATGG + Intergenic
968606899 4:1539840-1539862 GAGGACCTGCAGTCTGGGGAGGG - Intergenic
968849623 4:3070013-3070035 GGTGCACACCAGCCTGGGCAGGG - Intergenic
969694050 4:8725003-8725025 GGTGAGCTTCAGCATGAGGAGGG - Intergenic
969899434 4:10335307-10335329 GCTGACCTACAGCTTGGGAAAGG + Intergenic
974404160 4:61444409-61444431 GGTGAGCTCCAGTCAGGGGCTGG - Intronic
974628891 4:64457805-64457827 GGTGACCTAAAGCCTGGGATCGG + Intergenic
975110979 4:70626284-70626306 GCTGCCCTCCAGCCTGGGTGAGG - Intergenic
975203142 4:71615051-71615073 GTTGACCTCCAGCCAGGAGGTGG - Intergenic
975578656 4:75887669-75887691 GGTCACCTGCAGCCTGCAGATGG - Intronic
976180278 4:82392260-82392282 AGTGACCTCATGGCTGGGGACGG - Intergenic
976562746 4:86521229-86521251 GTTGGCCTCCAGCCAGGAGATGG + Intronic
976767445 4:88611809-88611831 GGTGTCCACCAGCATGGGTATGG + Intronic
976887893 4:90008062-90008084 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
980167161 4:129242816-129242838 GCTTACCTCCAGCCTAGGGATGG + Intergenic
980274629 4:130633435-130633457 GTTGACCTCCAGCCAGGAGGTGG - Intergenic
980418945 4:132533948-132533970 CTTGACATTCAGCCTGGGGATGG - Intergenic
984397240 4:179217362-179217384 ACTGAACTCCAGCCTGGTGATGG + Intergenic
985530899 5:433373-433395 GGTGACCTGGAGAGTGGGGAGGG - Intronic
986617842 5:9638549-9638571 GTTGTCCTCCAGCCGGGAGATGG + Intronic
988123584 5:26999199-26999221 CATGCCCTCCAGCCTGGTGACGG + Intronic
991405024 5:66293324-66293346 GGTGACATGCAGCCTGAGGACGG + Intergenic
992029133 5:72703043-72703065 CATGACCTTCAGCCTGGGGGCGG - Intergenic
992268100 5:75037838-75037860 AGTGCACTCCAGCCTGGGCAAGG + Intergenic
993606764 5:90000540-90000562 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
996495267 5:124148388-124148410 GGTGGCCTCCAGCCAGGAGGTGG + Intergenic
997472464 5:134124500-134124522 GGTGACCTCCTCCCAGGAGAAGG - Intronic
997531014 5:134581347-134581369 GGTGACCCAAAGCATGGGGAAGG - Exonic
999449082 5:151665146-151665168 GGTCACCTACAGCCCTGGGATGG + Intronic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1002382634 5:178841255-178841277 GGTGACCCCCACCCTGGCCAGGG + Intergenic
1002394030 5:178939649-178939671 GGTGAACTCCAGGCTTGGCAAGG - Intergenic
1002559427 5:180071630-180071652 GCTGACCTGCAGCCTGTGGCCGG - Exonic
1003954562 6:11149780-11149802 TGTGACCTCCAGACTGCAGAAGG - Intergenic
1005900875 6:30215143-30215165 ACTGCACTCCAGCCTGGGGACGG + Intergenic
1006825043 6:36928602-36928624 CTTCACCTCCACCCTGGGGAAGG + Intronic
1007633006 6:43283213-43283235 GGGGACCTGGAGCCTGAGGAGGG + Exonic
1007641712 6:43345904-43345926 GTTCAACACCAGCCTGGGGACGG + Intronic
1008514892 6:52309421-52309443 GGTCACCTCCAGGCTGGGCACGG - Intergenic
1010251737 6:73714300-73714322 GGTGGCCTCCCTCCTGGGGATGG + Intronic
1011610637 6:89146702-89146724 GGTGCCCTCCCGCCCGGGGCAGG + Intronic
1012203506 6:96435168-96435190 GGTGACCTCCAGTCAGGAGTTGG + Intergenic
1012696516 6:102391180-102391202 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
1012869868 6:104659732-104659754 GTTGACCTCCAGCCAGGAGTTGG - Intergenic
1012965661 6:105669922-105669944 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
1015394284 6:132717564-132717586 GGGGACCTGCTGCCTGGGGTGGG - Intergenic
1016041571 6:139437091-139437113 GCTGGCCTTCAGCCTGGGCATGG - Intergenic
1016456322 6:144234680-144234702 CCTGACCTCCAGGGTGGGGAAGG + Intergenic
1018654590 6:166023444-166023466 GGTGGCCTGGAGCCTGGTGAGGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019123424 6:169823770-169823792 GTTGGCCTCCAGCCAGGAGATGG + Intergenic
1019213246 6:170423077-170423099 AGCGCCCTCCAGGCTGGGGAAGG - Intergenic
1019467864 7:1200193-1200215 CTTGGCCTCGAGCCTGGGGAAGG + Intergenic
1019656452 7:2198632-2198654 GTTGGCCTGCAGCCTGGAGAGGG - Intronic
1019773312 7:2897181-2897203 GGTGACCTCTTCCCTGAGGATGG + Intergenic
1020095275 7:5365153-5365175 GGTGAACTCCAGCCAGGGTGGGG - Intronic
1020230535 7:6315004-6315026 ATTGCCCTCCAGCCTGGTGACGG - Intergenic
1020254952 7:6497814-6497836 AGTGACCTGCAGGCCGGGGAGGG - Exonic
1022320791 7:29286053-29286075 AGTGACCTCCTGGCTTGGGAAGG - Intronic
1022589049 7:31643503-31643525 GATGTCCTCCAGCCTGGTGTCGG + Exonic
1023638516 7:42236869-42236891 GGTGGTCCCCAGCGTGGGGACGG - Intronic
1024002338 7:45199050-45199072 GGAGAGCTCCACCATGGGGATGG - Intergenic
1026021049 7:66706445-66706467 ACTGCACTCCAGCCTGGGGACGG - Intronic
1026885128 7:73936806-73936828 ACTGCACTCCAGCCTGGGGACGG - Intergenic
1030155270 7:106448523-106448545 GGGGGACTCCAGCCTGGAGAGGG - Intergenic
1034377997 7:150663801-150663823 GGTCAGCACCAGCCTGGGGAGGG + Intergenic
1034393582 7:150803486-150803508 GGTGACCTCCAGCCTGAACCTGG - Intronic
1034501295 7:151452527-151452549 GCTGACCTCCTGCCTGGGGAAGG - Intergenic
1035032251 7:155869253-155869275 AGTGACCCCAGGCCTGGGGATGG + Intergenic
1035259213 7:157650791-157650813 GGTGACTTGCAGCCTTGGGCAGG + Intronic
1035478084 7:159157918-159157940 TGTGGCGTCCAGCCTGGGGCTGG + Intergenic
1036700626 8:11011421-11011443 GGTGAGCACCAGGCTGAGGAGGG + Intronic
1037581298 8:20247352-20247374 GGGGGTCTCCAGCCTGGGGAGGG + Exonic
1037718516 8:21421023-21421045 ATTGCCCTCCAGCCTGGGGCGGG - Intergenic
1038288895 8:26230876-26230898 GGCTTCCTCCAGCCTGGGGCAGG - Intergenic
1039579286 8:38650926-38650948 GGCGACGCCCAGCCTGGGAAGGG + Intergenic
1039936706 8:42051985-42052007 AGTGAGCTCCAGCCGGGGGGAGG + Exonic
1040820189 8:51547211-51547233 GGTGGCCTCCAGCCAGGAGGTGG - Intronic
1040947808 8:52902260-52902282 GGTGACTTCAAGGCTGAGGAAGG + Intergenic
1041244335 8:55876412-55876434 GGTGAGCTCCAGGCTAGGGGAGG + Intergenic
1046478525 8:114782412-114782434 GGTGACATTCAGGCTGGGCACGG + Intergenic
1048262024 8:132953254-132953276 GGGCTGCTCCAGCCTGGGGAAGG - Intronic
1048371666 8:133784008-133784030 GTTGACCTCCAGCCAGGAGGTGG + Intergenic
1048806842 8:138249047-138249069 GGTGACAGACAGCCTGGGGTAGG - Intronic
1049437458 8:142594356-142594378 GGAGTCCCCCAGCCAGGGGAAGG - Intergenic
1049482738 8:142834700-142834722 GGAGGCCTGGAGCCTGGGGACGG + Intronic
1049499417 8:142953537-142953559 GGTGCCCTGCAGCCTGGGATGGG - Intergenic
1049675153 8:143885959-143885981 GGGGGGCTCCAGGCTGGGGAGGG - Intergenic
1049682535 8:143926078-143926100 TGTGCTCACCAGCCTGGGGAAGG + Intronic
1050461229 9:5879329-5879351 GGTGCACTCCAGCCTGGGAAGGG + Intergenic
1051601306 9:18877703-18877725 GTTGACCTCCAGCCAGGAGGTGG + Intronic
1054818467 9:69498055-69498077 GGTAATCTCCTCCCTGGGGAGGG + Intronic
1055373287 9:75623840-75623862 TGTTGCCTCCAGACTGGGGAGGG - Intergenic
1056896146 9:90552523-90552545 GCTGACCTCCAGCCTGAGCTAGG - Intergenic
1057490093 9:95513823-95513845 CCTTTCCTCCAGCCTGGGGAGGG - Intronic
1057600377 9:96451357-96451379 GGTGTCCTGCTGCCTGTGGACGG + Intronic
1057659876 9:96991291-96991313 AGTGCACTCCAGCCTGGGCAAGG + Intronic
1059052058 9:110936990-110937012 GGAGACTTCAAGCCTAGGGAGGG + Intronic
1059300459 9:113308425-113308447 CGTGAATCCCAGCCTGGGGATGG + Intergenic
1059344018 9:113616190-113616212 GGGGGACTCCAGACTGGGGAAGG + Intergenic
1060207494 9:121690786-121690808 GGTGTCCTCTGCCCTGGGGAAGG + Intronic
1060943722 9:127557885-127557907 GGTGACCTCCACTCTAGAGATGG + Intronic
1062077057 9:134595183-134595205 GGTCACCACCTGCCTGGGAATGG + Intergenic
1062454444 9:136629079-136629101 CTTGACCCCCAGCCTGGGCATGG + Intergenic
1062523746 9:136970063-136970085 AGTGGCCTCCAGGATGGGGAAGG + Intronic
1185464264 X:345844-345866 GGGGAGCTCCAGCATGGGGGTGG + Intronic
1185468842 X:370745-370767 GGTGACCACTGGCCTTGGGAGGG + Intronic
1185819305 X:3186385-3186407 ACTGCACTCCAGCCTGGGGAGGG - Intergenic
1186308425 X:8290168-8290190 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
1187698915 X:21946222-21946244 TGAGACCCCCAGGCTGGGGAGGG + Intronic
1189567244 X:42255315-42255337 GTTGGCCTCCAGCCAGGAGATGG - Intergenic
1190227899 X:48560176-48560198 AGTGACCTCAAGCATGCGGAGGG - Exonic
1190234387 X:48604686-48604708 GGTGACCTCCCATCTAGGGATGG + Intronic
1191052065 X:56204871-56204893 GGTAACCTACTGCTTGGGGATGG + Intergenic
1191098973 X:56704780-56704802 TGGGACCTCCAGCCTGGAGGAGG - Intergenic
1191805090 X:65127474-65127496 GTTGACCTCCAGCCAGGAGGTGG + Intergenic
1192007654 X:67234515-67234537 GGTGACAGCAAGGCTGGGGAGGG + Intergenic
1192524316 X:71828434-71828456 GGTGACCTGGAGCCTGGGATTGG + Intergenic
1192691180 X:73366638-73366660 GTTGACCTCCAGCCAGGAGGTGG + Intergenic
1192981655 X:76350671-76350693 GTTGTCCTCCAGCCTGGAGGTGG - Intergenic
1194181466 X:90715853-90715875 GTTGACCTCCAGCCAGGAGGTGG - Intergenic
1194337506 X:92665965-92665987 GTTGGCCTCCAGCCAGGGGGTGG - Intergenic
1194470206 X:94285054-94285076 GTTGACCTCCAGCCAGGAGGTGG + Intergenic
1196245041 X:113390918-113390940 TGTTGCCTCCAACCTGGGGAAGG - Intergenic
1199170197 X:144726371-144726393 GTTGACCTCCAGCCAGGAGGTGG - Intergenic
1199521471 X:148741119-148741141 GTTGACCTCCTGCCAGGGGGTGG + Intronic
1200060730 X:153482605-153482627 GGAGACTGCCAGCCTGGGTAAGG + Intronic
1200528090 Y:4297768-4297790 GTTGACCTCCAGCCAGGAGGTGG - Intergenic
1200645926 Y:5782707-5782729 GTTGGCCTCCAGCCAGGGGGTGG - Intergenic