ID: 1160792619

View in Genome Browser
Species Human (GRCh38)
Location 19:929570-929592
Sequence GCAGCGGGCGCGCCAGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 321}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160792610_1160792619 28 Left 1160792610 19:929519-929541 CCGCAGGGCCATGAAACTACAGG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG 0: 1
1: 0
2: 5
3: 36
4: 321
1160792614_1160792619 5 Left 1160792614 19:929542-929564 CCGTGATGGAGACGCTGTTGCAG 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG 0: 1
1: 0
2: 5
3: 36
4: 321
1160792612_1160792619 20 Left 1160792612 19:929527-929549 CCATGAAACTACAGGCCGTGATG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG 0: 1
1: 0
2: 5
3: 36
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160792619 Original CRISPR GCAGCGGGCGCGCCAGGAGC TGG Exonic
900240764 1:1616214-1616236 GGAACGGGCGGGCCAGGGGCGGG - Intronic
900299759 1:1970672-1970694 CCAGCGCCGGCGCCAGGAGCTGG - Exonic
900389668 1:2428484-2428506 GCACCGGGCGAGCCAGACGCAGG - Intronic
900978080 1:6029603-6029625 GCAGCGGGGGCTGCAGGAGCTGG - Intronic
901006244 1:6172979-6173001 GCAGGGGCCAAGCCAGGAGCTGG + Intronic
901842866 1:11964779-11964801 GCAGCAGGTCAGCCAGGAGCGGG + Exonic
902329218 1:15722861-15722883 GCAGCAGGCGTGTCAGGAGGGGG - Intronic
902916691 1:19644111-19644133 GGGGCGGGCGGGCCAGGAGAGGG + Intronic
903184687 1:21622467-21622489 GGCGCGCGCGGGCCAGGAGCCGG - Intronic
904625145 1:31798236-31798258 GCAGCTGGCCCCCCAGGAGCTGG - Exonic
904674434 1:32190066-32190088 GCAGCGGGCCCGGGAGGAGGAGG + Exonic
904814092 1:33182124-33182146 GCAGCGGGCGGGGGAGGGGCGGG + Intergenic
905183108 1:36178546-36178568 GCAGCGGGAGCGCGAGGAGCAGG + Exonic
905892434 1:41525850-41525872 GCAGGGGGCGCGCCAGGAGAGGG + Intronic
906140489 1:43531229-43531251 GCTGCGGGCGCGGCAGGTGGGGG - Intronic
906155796 1:43613272-43613294 GCAGCAGACGTGACAGGAGCTGG - Intronic
907278057 1:53327864-53327886 GCAGCAGCAGCGCCAGAAGCCGG + Exonic
909475277 1:76074816-76074838 GCAGCGGGCGCGCCTGGGTCAGG - Exonic
910138358 1:83998951-83998973 GCAGCGGGGACGCGAGGACCCGG - Exonic
911664757 1:100539761-100539783 GCAGCGCGGGCGGCAGGGGCTGG - Exonic
912162822 1:107007033-107007055 GCAGTGGGAGATCCAGGAGCTGG - Intergenic
912381448 1:109250005-109250027 GCGGCGGGGCCGGCAGGAGCCGG + Exonic
914843339 1:151266027-151266049 GCAGCGGCAGCGGCAGGAGGAGG + Exonic
915325269 1:155078768-155078790 GTCGGGGGCGCGCCAGGGGCGGG + Intergenic
915549557 1:156624409-156624431 GAAGCAGGCGTGCGAGGAGCAGG + Exonic
915740192 1:158113431-158113453 GCAGGGGGCTCGGCAGGCGCGGG + Intergenic
919103543 1:193122158-193122180 GCAGCGGCGGCGCCCCGAGCCGG + Exonic
920335391 1:205241806-205241828 GCAGTGGGGGCGGCAGCAGCGGG + Exonic
920859404 1:209693076-209693098 GCAGAGGGAGCCCCAGGAGTGGG - Intronic
921556141 1:216601076-216601098 GCAGCGCGGGCGGCAGCAGCGGG + Intronic
922513182 1:226186558-226186580 GCAGCGGTGGCGGCAGCAGCGGG + Exonic
923299784 1:232630279-232630301 GCACCGGCTGCGCCCGGAGCCGG - Intergenic
923372698 1:233328478-233328500 GAAGGCGGCGCGCCAGGACCCGG + Exonic
924511303 1:244730842-244730864 GAAGGCGGCGCGCCTGGAGCGGG - Intergenic
1065189827 10:23199018-23199040 GGAGCGGGCTCGGCAGGAGCCGG - Intergenic
1067111970 10:43407554-43407576 GCAGCCGGCGCAGCAGGAGCCGG + Intronic
1067686066 10:48466581-48466603 GCGGCGGGCGCGCAACAAGCGGG + Intronic
1069564002 10:69451359-69451381 GGAGGGGGCGGGCCAGGGGCGGG - Intergenic
1072021860 10:91410406-91410428 GCGGCGGGAGCGCCAGGCGGCGG - Exonic
1072290319 10:93959242-93959264 GCAGCGGCAGCGGCAGGAGGAGG - Intergenic
1075885468 10:125896150-125896172 GGGGCGGGCGCGCCCCGAGCCGG - Intronic
1076427527 10:130378383-130378405 GCAGTGGGAGGACCAGGAGCAGG - Intergenic
1076480953 10:130785027-130785049 GCAGTGGGGGCGCCGGGAGCAGG - Intergenic
1076858040 10:133127116-133127138 GCAGCGGGTGCGGGCGGAGCAGG - Intronic
1076906071 10:133361756-133361778 GAAGCGTGGGTGCCAGGAGCTGG + Intergenic
1077012704 11:385941-385963 TCAGAGTGGGCGCCAGGAGCAGG - Intergenic
1077141523 11:1026917-1026939 TAAGGGGGCGCGCGAGGAGCAGG - Intronic
1077495879 11:2886218-2886240 ACACCGGACCCGCCAGGAGCCGG - Intergenic
1077610847 11:3642347-3642369 GGAGCGGGCGCGCCAGGGCAGGG + Intergenic
1078233322 11:9461521-9461543 GCAGCGGGGGCGCCGGGGACAGG + Intronic
1078507618 11:11964553-11964575 GGAGGAGGTGCGCCAGGAGCTGG - Exonic
1082657697 11:55872936-55872958 GCAGCAGGCGCTGCAGGGGCAGG + Intergenic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1084426074 11:69085191-69085213 CCACCTGGCGGGCCAGGAGCCGG - Exonic
1084557359 11:69883041-69883063 GCAGCTGGAGCCCCAGAAGCTGG - Intergenic
1085011081 11:73142158-73142180 GGGGCGGGGGCCCCAGGAGCAGG + Exonic
1085266687 11:75241622-75241644 GCTCCAGGCGCGCCAGGCGCAGG - Exonic
1088223229 11:107591225-107591247 GCTGCGGGCGCGGAAGGGGCGGG - Exonic
1088604284 11:111513126-111513148 GCAGCGGGCGCTCGCGGGGCAGG - Intergenic
1090238149 11:125164590-125164612 GCAGCGGCCGGGCCGGGAGTGGG + Intergenic
1091558683 12:1594459-1594481 GCAGCGGCGGCGGCAGGAGGCGG - Intronic
1091791307 12:3273710-3273732 GGAGAGGGTGCGGCAGGAGCAGG - Intronic
1094703934 12:32896838-32896860 GCGGGGGGCGGGCCAGGGGCGGG - Intronic
1101254180 12:102961344-102961366 GCAGGCGGCGAGCGAGGAGCCGG - Intergenic
1101340806 12:103840868-103840890 GAAGCGGGCGCCCTAGGACCCGG - Intronic
1102518523 12:113465478-113465500 GCAGCGGGCGAGAAAGGGGCCGG - Intronic
1103488196 12:121296741-121296763 GCGGCGGGCGCGCGGGGGGCGGG + Intronic
1103649708 12:122422836-122422858 GCGGCGGGCGCGCCGGGGCCAGG - Intergenic
1103856296 12:123973052-123973074 GGAGCGCGCGCGCCGGGCGCTGG + Intronic
1104632435 12:130414591-130414613 GCTGCGGCCGTGCCAGGGGCAGG + Intronic
1104811296 12:131621868-131621890 GCAGCAGGAGAGCCAGGAGGAGG - Intergenic
1105388766 13:19957802-19957824 GCTGCGGGCTCCCCTGGAGCTGG - Intergenic
1107123495 13:36819725-36819747 GCAGCGGGGGCGCCCGGAGGCGG + Exonic
1108893467 13:55293613-55293635 GCAGAGGGTGAGGCAGGAGCAGG - Intergenic
1116826488 14:49677861-49677883 GCAGTGTGCTGGCCAGGAGCTGG - Intronic
1118849343 14:69572476-69572498 GCGGCGGGAGCGCGAGGAGCGGG - Exonic
1120780158 14:88479579-88479601 GCAGCGAGTGCGCCACGGGCAGG + Exonic
1121017284 14:90556418-90556440 GCAGCAGGCCCCCCAGCAGCAGG - Intronic
1122130915 14:99604237-99604259 GCGGCGGGGGCTCCGGGAGCTGG - Intergenic
1122517681 14:102320023-102320045 GGAGCAGGCGCGGCAGGCGCGGG - Exonic
1122602936 14:102930283-102930305 GCAGCGGCGGCGCCACCAGCAGG - Exonic
1122910718 14:104826574-104826596 CCAGGGGGCGCGCGGGGAGCGGG - Intergenic
1122924963 14:104895199-104895221 GCAGCAGCCTGGCCAGGAGCTGG - Exonic
1123036793 14:105474917-105474939 GCACCGAGCGGGCCGGGAGCGGG - Intronic
1123041114 14:105490595-105490617 GCCGCGGGCGGGCGAGGATCGGG + Intronic
1202872590 14_GL000225v1_random:177767-177789 GGGGCGGGCGCGCCCCGAGCCGG + Intergenic
1125200062 15:37095385-37095407 GGAGCTGGCGAGCGAGGAGCAGG - Intronic
1125685015 15:41558949-41558971 GCTGCGGGCGGGCCGGGAGGAGG + Intronic
1125720961 15:41844968-41844990 GCAGCGGTACCGGCAGGAGCTGG + Exonic
1126725092 15:51623178-51623200 GCCGGGGACGCGCCACGAGCCGG + Intergenic
1126837216 15:52679288-52679310 ACAGCGGGCGGGCAAGGAGCTGG - Intronic
1127103156 15:55587954-55587976 GCAGCGGCCCCGCGAGGAGGAGG - Intronic
1127982719 15:64046374-64046396 GCGGCGGGCGCGGCGGGAACGGG + Intronic
1128877704 15:71215459-71215481 GCAGCGTGCGAGGCAGGGGCAGG - Intronic
1129220128 15:74127703-74127725 GCAGGGGGCGCGCGCGGACCAGG + Exonic
1129452141 15:75657161-75657183 CCAGCGGGTGGGCCAGCAGCTGG + Exonic
1131092452 15:89632918-89632940 GCGGCGGGCGCTGGAGGAGCTGG - Exonic
1131144264 15:90001484-90001506 GCGGCGGGCGCGCGTGGAGGCGG + Exonic
1131263515 15:90902624-90902646 GGAGCGGGCCCGGGAGGAGCCGG + Intronic
1131466053 15:92655614-92655636 GCAGCAGCAGCGGCAGGAGCGGG + Exonic
1132889571 16:2196989-2197011 GCAGCGGGCGGGCGGGGACCGGG + Intergenic
1132991599 16:2798451-2798473 GCAGAGGGCGCGCCAGGCCGCGG + Intergenic
1133188467 16:4116416-4116438 ACAGCGGGCGGGGCAGGGGCCGG - Intergenic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134644738 16:15857162-15857184 CCGGCGGGAGCGCAAGGAGCTGG + Intergenic
1135294610 16:21268416-21268438 GCAGCGGCCTCACCAGGAGCTGG + Intronic
1135517548 16:23148685-23148707 GCAGCTGGCGCACCTGGTGCGGG - Exonic
1135709276 16:24701235-24701257 GCAGGGGGAGCTTCAGGAGCTGG + Intergenic
1136349324 16:29696872-29696894 GCAGCTGGGGCGCGGGGAGCCGG - Intronic
1136590423 16:31214945-31214967 GCAGCTGGCGCGCCTGGTGGAGG + Exonic
1139402817 16:66696210-66696232 GGAGAGGGGGCGCGAGGAGCGGG + Intronic
1139511644 16:67431329-67431351 GCAGCGGGCGGCCCAGACGCAGG - Exonic
1139637145 16:68264593-68264615 TGGGCGGGCGCGCCGGGAGCGGG + Intronic
1139785011 16:69385746-69385768 CCGGCGGGGGCGCCACGAGCCGG - Exonic
1140025720 16:71289070-71289092 CCAGCGGGTGAGCCAGGGGCTGG - Intronic
1140188457 16:72794917-72794939 GCAGCTGGCTGGCCAGGAGTGGG + Exonic
1141172789 16:81701779-81701801 GCAGCGGGAGCTGAAGGAGCTGG + Exonic
1141608444 16:85168784-85168806 GCTGCGGGCGCCCCTGGAGGCGG - Intergenic
1141667463 16:85473314-85473336 GCAGGGGCAGGGCCAGGAGCTGG + Intergenic
1142185008 16:88690687-88690709 GCAGGGAGGGCGCCAGGAGTGGG + Intergenic
1142232131 16:88904963-88904985 CCAGGGGCAGCGCCAGGAGCAGG - Intronic
1143493392 17:7296550-7296572 GCAGAGGGCGCGCCGGGACCGGG - Intergenic
1146062252 17:29613516-29613538 GCGGCGCGCGCGCCAGGAGGAGG + Exonic
1147317022 17:39625941-39625963 GGAGCGGGAGCGGGAGGAGCTGG - Intergenic
1147508766 17:41047181-41047203 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147509505 17:41055125-41055147 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147510013 17:41059964-41059986 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147510606 17:41065759-41065781 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147512644 17:41084541-41084563 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147513860 17:41097638-41097660 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147514817 17:41105753-41105775 GCAGCTGGGGCGACAGCAGCTGG - Exonic
1147514838 17:41105888-41105910 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147515955 17:41117839-41117861 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147515977 17:41117974-41117996 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147515993 17:41118079-41118101 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147516579 17:41123628-41123650 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147517967 17:41140131-41140153 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147518881 17:41149333-41149355 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147518914 17:41149528-41149550 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147679019 17:42227618-42227640 GCACCAGGCCCTCCAGGAGCTGG + Exonic
1147686643 17:42289911-42289933 GCACCAGGCCCTCCAGGAGCTGG - Exonic
1149991155 17:61384275-61384297 GCGGAGGGCCCTCCAGGAGCGGG - Intronic
1150132831 17:62678551-62678573 CCAGGGGGCCTGCCAGGAGCTGG + Exonic
1150654900 17:67033187-67033209 GCAGCGGGAGGGCCAGGAATGGG - Exonic
1151408913 17:73907747-73907769 GCACCGGGAGTGCCAGGAGGTGG + Intergenic
1151580143 17:74972831-74972853 GCGGCGGGCGCTGCAGGTGCAGG - Intronic
1151584959 17:75003300-75003322 GGAGCGGCAGCGCAAGGAGCGGG + Exonic
1151717816 17:75840382-75840404 GCAGCGGAGGCGACAGGAGGTGG + Intronic
1152586236 17:81190661-81190683 GCTGCAGGCCCGCCAGCAGCTGG - Exonic
1152758646 17:82097525-82097547 CCAGCGTGCGGGCCTGGAGCTGG - Intronic
1153301532 18:3596125-3596147 GCAGGGAGAGTGCCAGGAGCAGG + Intronic
1153514321 18:5890746-5890768 GCGCGGGGCGCGCCGGGAGCCGG - Exonic
1153886949 18:9475628-9475650 GCAGCGTGAGCGCGAGGAGGCGG + Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1155209433 18:23587609-23587631 TCAGTGGGGGCACCAGGAGCTGG - Intergenic
1155526084 18:26717424-26717446 GCAGCGGAAGCAGCAGGAGCTGG + Intergenic
1156099628 18:33578368-33578390 GCGGCGGGCGGGCCGGGGGCGGG - Intergenic
1157752970 18:50194820-50194842 GCCGCGGGGCAGCCAGGAGCCGG - Exonic
1160688704 19:450159-450181 GCAGCCGGCGCTACAGGAGGGGG + Intronic
1160763381 19:796815-796837 ACTGCGGGCGCGCCATGATCCGG - Intergenic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1160982770 19:1823818-1823840 ACAGCGGGGGCACCTGGAGCAGG + Intronic
1161069063 19:2251477-2251499 CGAGCAGGCGCGCCAGCAGCGGG - Exonic
1161384285 19:3982750-3982772 GCAGCGGGATCTGCAGGAGCCGG - Intronic
1161428523 19:4217518-4217540 GCTGCGGGCGGCCCTGGAGCAGG + Exonic
1161668978 19:5594045-5594067 GGAGCGGGAGCGCATGGAGCGGG - Exonic
1161677678 19:5661632-5661654 GGAGCGGGAGCGCATGGAGCGGG + Exonic
1161951833 19:7471761-7471783 GGAGGGGGCGGGGCAGGAGCTGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163347091 19:16750079-16750101 GCAGCGGGTGCTCCTGGACCCGG + Exonic
1163368687 19:16889988-16890010 GCAGCGGGTGCACCAGGGCCAGG - Exonic
1163433466 19:17281994-17282016 GCCGGGGGCGGGCCAGGAGTGGG + Intronic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164222134 19:23204149-23204171 GCAGCGGGCGCGCCAACGCCCGG - Intergenic
1164713468 19:30375408-30375430 GCAGCAGGCGCGCAGGTAGCGGG - Intronic
1165123853 19:33580545-33580567 GCACCTGGCTCGCCAGGGGCTGG + Intergenic
1165204565 19:34172629-34172651 GCGGCGGCGGCGCCATGAGCGGG + Exonic
1165213694 19:34254619-34254641 GGAGCGGGCGCGGCGGGCGCAGG + Intronic
1165213745 19:34254773-34254795 ACAGCGGGCGGGCAAGGGGCGGG - Intronic
1165313012 19:35039973-35039995 GCGGCCGGCGGGGCAGGAGCTGG - Intronic
1165459493 19:35936415-35936437 GCCGCGGGAGCGCCTGGACCCGG + Intronic
1165899306 19:39161469-39161491 GCAGAGGGGGCGGCATGAGCAGG - Intronic
1166097364 19:40549263-40549285 GGAGCCGGCGAGCAAGGAGCTGG + Exonic
1166123992 19:40702881-40702903 GCAGCGGGGGAGACAGGAGAGGG - Intronic
1166524328 19:43501739-43501761 GCAGCGCGGCCGCCAGCAGCGGG - Exonic
1166824779 19:45602016-45602038 GGAGCGGTCTCGCCACGAGCAGG + Intronic
1166862173 19:45816872-45816894 GCAGCTGCCGCCCCAGCAGCTGG - Exonic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167258223 19:48443402-48443424 GGGGCTGGCGCGCCGGGAGCTGG + Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167375329 19:49108017-49108039 GGAGCGGGCCCGGCGGGAGCGGG + Exonic
1167926076 19:52821754-52821776 GCAGAGGGCGGGGCCGGAGCGGG + Intronic
1167930260 19:52857740-52857762 GCAGAGGGCGGGGCCGGAGCGGG + Intergenic
925959771 2:9003795-9003817 GCGGCGGGCGCGGGAGGAGGTGG - Exonic
926724175 2:15984551-15984573 GCAGCGGGAGGGCAAGGCGCTGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
928511909 2:32010541-32010563 GCAGCGGGGACGCCGGGGGCCGG - Exonic
929650572 2:43676462-43676484 GAAGGGGGCGGGGCAGGAGCGGG + Intronic
930089473 2:47521211-47521233 GCCAGGGGCGCGCCAGGAGCCGG + Exonic
931670830 2:64645241-64645263 GCAGCGGGAGAGCCCGGAGGAGG - Intronic
932700020 2:73985514-73985536 GCGGCGGGCGCGGCGGGCGCGGG + Intergenic
934993279 2:98936189-98936211 GAAGCCGGCGCGCCTGCAGCTGG - Exonic
935301666 2:101698151-101698173 CGAGCGGGCGCGCGGGGAGCGGG + Intronic
935318225 2:101859049-101859071 GCAGCAGCTGCTCCAGGAGCAGG + Exonic
935971525 2:108534456-108534478 GCTCCGGGCCCGCCAGTAGCCGG + Intronic
937160950 2:119760233-119760255 GCAGCGGTCGCGCCACGACCCGG - Exonic
938305747 2:130253046-130253068 CCTGCGGGCGCCCGAGGAGCGGG + Intergenic
942653982 2:178195256-178195278 GCTGCAGGGGCGCCAGCAGCGGG - Intronic
945306777 2:208266385-208266407 GCAGCCGGCGCGGCCGGGGCAGG + Exonic
947874812 2:233461132-233461154 GCACCTGGCGGGCGAGGAGCAGG - Intronic
947992365 2:234497362-234497384 GCAGGGGGCGGGCTAGGACCCGG - Intergenic
948473795 2:238203638-238203660 GCAGCGGGCGGGCGACGGGCAGG + Exonic
948805977 2:240453554-240453576 GCAGCGGGTGCGGCAGGCACGGG - Intronic
1170571557 20:17635601-17635623 GCAGCTGGCCCGCCTGCAGCAGG - Exonic
1171340197 20:24421335-24421357 CCAGTGGGCGGGGCAGGAGCTGG + Intergenic
1172446825 20:34997544-34997566 GCAGCGGGTGCGGCAGAAGCTGG + Exonic
1172526244 20:35601964-35601986 GCACCCCGCGCGGCAGGAGCAGG + Intergenic
1173251558 20:41366538-41366560 GCGCAGGCCGCGCCAGGAGCGGG + Exonic
1173672921 20:44810437-44810459 CCGGCGGGCGGGCCAGGAGCTGG + Intergenic
1173704673 20:45101030-45101052 GCAGCGGGGCCGCCTGCAGCAGG - Exonic
1173729215 20:45316995-45317017 GCTGCGCCCGCGCCAGGCGCGGG + Exonic
1173909734 20:46657776-46657798 GCAGAAGGCGAACCAGGAGCAGG + Intronic
1174588122 20:51624406-51624428 GCAGAGGGCGCGTGAGGACCTGG - Intronic
1176099657 20:63359165-63359187 GCAGGGGCCGGGGCAGGAGCAGG - Intronic
1176107982 20:63398591-63398613 GCAGAGGGCAGGCAAGGAGCGGG + Intergenic
1178331385 21:31696599-31696621 GCAGCGGGTGCAGCAGCAGCAGG + Exonic
1178839917 21:36130173-36130195 GCAGCGGGGACGCCGGGGGCCGG + Intergenic
1179512048 21:41879477-41879499 GCAGCGGGCGCGCGCGGGGCGGG + Exonic
1179959199 21:44758833-44758855 GCGGCAGGCGCCCCAGGAGTGGG + Intergenic
1180225771 21:46391276-46391298 GCAGCAGGCGGCCCAGGAGCAGG + Exonic
1180796773 22:18609673-18609695 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180837266 22:18936166-18936188 CCAGCGGCCGTGCCAGGAGGTGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1180843640 22:18970443-18970465 GCCGCGGGCGCGCAGGGCGCGGG - Intergenic
1180866312 22:19122015-19122037 GCAGGGGCCGCGCCTGGGGCAGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181175492 22:21032530-21032552 GCAGCGGCTGCGGCAGCAGCAGG - Exonic
1181224951 22:21385598-21385620 GCGGCGCGAGTGCCAGGAGCTGG + Exonic
1181253681 22:21549215-21549237 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1182254887 22:29031045-29031067 GCAGGGGCAGCGGCAGGAGCGGG - Intronic
1182429125 22:30289829-30289851 GGAGGGGGCGCGTCAGGGGCGGG - Intronic
1184236873 22:43187362-43187384 GCAGGGGGCGCGGCAGGGGCGGG - Intergenic
1185077583 22:48691588-48691610 ACGGAGGACGCGCCAGGAGCAGG + Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
1203287359 22_KI270734v1_random:161465-161487 CCAGCGGCCGTGCCAGGAGGTGG - Intergenic
950316229 3:12004327-12004349 GGAGCGGGCGGGGCAGGGGCGGG - Intergenic
950487157 3:13280654-13280676 GCAGCGGGTGTCCTAGGAGCTGG + Intergenic
950668018 3:14509077-14509099 GCAGGGGGCGCTCCAGGAGCAGG + Intronic
951613999 3:24521943-24521965 TGAGCGGGCGGGCGAGGAGCGGG + Intergenic
953793742 3:45967416-45967438 GCAGCTTGCCCTCCAGGAGCTGG + Exonic
953885438 3:46712272-46712294 GCAGTGGGAGTGCCAGGAGCAGG + Exonic
953981896 3:47417504-47417526 GCAGCGGGTGTACCAGGAGGAGG - Exonic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954138962 3:48595279-48595301 GCAGCGGCGGCGGCGGGAGCGGG - Intergenic
954468869 3:50674948-50674970 GCCGCGGCGGCGCCGGGAGCCGG + Intergenic
957646595 3:82939056-82939078 GCAGAGCGGGTGCCAGGAGCAGG - Intergenic
958719048 3:97822330-97822352 GCAGCGGACCGGCCTGGAGCTGG - Exonic
960056355 3:113279131-113279153 GGAGCGGGCCCGTCAGGAGCAGG + Intronic
960998083 3:123352431-123352453 GCAGCGGGAGAACCAGCAGCAGG - Exonic
962301854 3:134250515-134250537 GCGGCGGCAGCGCCAGGCGCGGG + Exonic
966919482 3:184602452-184602474 GCAGAGGCAGCGCCAAGAGCTGG - Intronic
967391053 3:188954781-188954803 GCAGAGGGCGCTCTTGGAGCAGG - Intronic
967858522 3:194135127-194135149 GGCGTGGGCGCGCCTGGAGCCGG - Intergenic
968434066 4:576081-576103 GCGGCGGGCGCGCGGGGTGCGGG - Intergenic
968753488 4:2402351-2402373 GCAGCGGGCGGGGCGGGAGATGG - Intronic
969369180 4:6720429-6720451 CCAGGGGGCGCTGCAGGAGCGGG + Intergenic
969676940 4:8619509-8619531 GCTGCCTGCGCGCCCGGAGCGGG - Exonic
969716862 4:8871964-8871986 GCAGCGGCCGCGCTCGGGGCCGG - Intergenic
972725769 4:41745752-41745774 ACAGCGGGCGAGCCAGGGCCCGG - Exonic
979455530 4:120922464-120922486 GCACAGGGCGCGCGAGGTGCAGG + Intronic
980063405 4:128155856-128155878 GCAGAAGGAGCGCCTGGAGCTGG + Intronic
981081891 4:140644651-140644673 GCAGCGGGCGGCCCAGGCCCTGG - Intronic
981475163 4:145180359-145180381 CCAGCGTGCGCGCCAGGGGCGGG - Intergenic
985486846 5:156640-156662 GCAACGGGAGCCCCAGGAGGAGG - Intronic
990449718 5:55923348-55923370 CCAGCGGCAGCTCCAGGAGCGGG - Intergenic
997583936 5:135033895-135033917 GCGGCGGGCGCTCCAGGGGCCGG + Exonic
999120728 5:149207338-149207360 GCAGCAGGCGTGCAAGGAACAGG - Intronic
1002065943 5:176651672-176651694 GCAGCGGGCGGGCGTGGAGCTGG + Intronic
1002419312 5:179137497-179137519 GCTGCGGGCTCGGCAGGGGCCGG - Intronic
1002898001 6:1390183-1390205 GCGGCGCGGGCGCCGGGAGCGGG + Exonic
1003049290 6:2765583-2765605 GCTGCGGCCGCGCCGGGCGCCGG + Exonic
1003426019 6:5999023-5999045 GCACCGGGAACGCCGGGAGCAGG + Exonic
1005421115 6:25652169-25652191 GGGACAGGCGCGCCAGGAGCGGG + Intergenic
1006333983 6:33411016-33411038 GCAGCGGCAGCGGCAGGAGGAGG - Exonic
1006366908 6:33621377-33621399 GCGGCGGGCGCGCCAAGACGTGG + Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1011044599 6:83067758-83067780 GAAGCGGCCGAGCCAGCAGCAGG + Exonic
1013175814 6:107675522-107675544 GCAGCGGGCTGGCCAGGGGATGG + Intergenic
1015376143 6:132512828-132512850 GCCGCAGGCGCTCCGGGAGCTGG + Intronic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1016010770 6:139135556-139135578 GCGGCGGGCGCGCCGGGCGCCGG + Exonic
1016339792 6:143049982-143050004 ACAGCGGGGGAGCCAGAAGCAGG - Intergenic
1017174942 6:151494059-151494081 GAAGCGGCGGCGCCGGGAGCCGG - Exonic
1017877442 6:158536526-158536548 GCCGCGAGCACGCGAGGAGCTGG - Exonic
1018247810 6:161839278-161839300 GCTGAGGGAGCGCCTGGAGCTGG + Intronic
1018867127 6:167754904-167754926 ACAGCGGCCTCCCCAGGAGCTGG - Intergenic
1019200053 6:170306803-170306825 GCAGCGGGCGCGTCTGCGGCTGG + Exonic
1019343351 7:518626-518648 GCAGCGGGCGCTGCAGCAGCGGG - Intronic
1019525684 7:1479453-1479475 GCAGCGGGCAGGCCAGGAAGTGG + Exonic
1020224934 7:6272523-6272545 GCAGCCGGCGAGCCGGGGGCCGG + Exonic
1021827944 7:24573369-24573391 GCGGCGGGGGCGACCGGAGCTGG + Exonic
1022102607 7:27177449-27177471 GCAGCCGGCCCGCCTGCAGCCGG - Intronic
1022400184 7:30028820-30028842 GCCGGGGGCGCGCCGGGGGCCGG + Intronic
1023255818 7:38311424-38311446 GCAGAGGGCGCGGCGGGAGGGGG - Intergenic
1023286959 7:38630874-38630896 CCTGCGGGCGCGCTGGGAGCCGG + Intronic
1027231345 7:76274413-76274435 GCAGTGAGCTGGCCAGGAGCAGG + Intronic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1028477149 7:91265024-91265046 GCAGCTGGCGCGCCAATCGCCGG - Exonic
1029443852 7:100602369-100602391 GCAGCGGTGGCGGCAGCAGCAGG - Exonic
1032125377 7:129189187-129189209 GCAGCAGCAGCCCCAGGAGCGGG - Exonic
1032394757 7:131581466-131581488 GAAACGGGTGGGCCAGGAGCCGG - Intergenic
1033477101 7:141701946-141701968 GCAGCCCGGGCGCCTGGAGCTGG - Exonic
1034285419 7:149880525-149880547 GCAGCTGGCCAGCCAGGAACTGG - Exonic
1035021921 7:155805300-155805322 GGAGCGGGGGCGGCAGGGGCGGG - Intronic
1035022102 7:155806030-155806052 GCAGTGGGGGCTCCAGAAGCGGG + Intronic
1035717205 8:1763659-1763681 GCGGCGGGCGCGGGAGGGGCGGG - Intronic
1035751933 8:2002383-2002405 GCTGCGAGCGCGCCTGGCGCAGG - Exonic
1037589939 8:20303938-20303960 GAGGCCGGCGCGCCTGGAGCTGG - Exonic
1038761136 8:30384834-30384856 GCAGGGCGCGGGCCGGGAGCGGG - Exonic
1040386426 8:46917833-46917855 GCAGGGGGCGCGCCAGGCGCGGG + Intergenic
1041280929 8:56211003-56211025 GCAGCGGCGGCGGCAGGAGGAGG - Intronic
1042227030 8:66522194-66522216 GGACCGGGCTCGCCAGCAGCTGG + Intergenic
1046103899 8:109644674-109644696 GCAGCGGCGGCGCGAGGAGCCGG - Exonic
1048317809 8:133375122-133375144 GCAGCGGGCCAGCCTGGAGCAGG - Intergenic
1048484225 8:134832149-134832171 GCAGGGGGCGCGGCGAGAGCTGG + Intergenic
1049275432 8:141717896-141717918 GGAGGGGGCGTGCCAGGAGCTGG - Intergenic
1049788233 8:144461534-144461556 GCAGCCAGTGCTCCAGGAGCCGG - Intronic
1050308645 9:4330840-4330862 GCACCAGGCGAGCCAGGAGTGGG + Intronic
1053129959 9:35609218-35609240 ACAGCGGGAGGGCCAGGACCTGG - Exonic
1055611808 9:78031693-78031715 GGAGCGGGCGCGCCGGGCGCGGG - Intergenic
1055945579 9:81688912-81688934 GCGGAGGGCGCGCCGGGAGGCGG + Exonic
1056378458 9:86036230-86036252 GCAGCGGCGCAGCCAGGAGCAGG - Intronic
1056580077 9:87884005-87884027 GAAGCGGGAGGTCCAGGAGCAGG + Exonic
1057135835 9:92687197-92687219 GCAGCAGGTGCTCCAGGAGTAGG - Intergenic
1057192638 9:93096108-93096130 GTAGCGGGCGCGGAAGGGGCGGG + Intergenic
1057592408 9:96383706-96383728 GAAGAGGGCGCGGCAGGAACAGG + Intronic
1057665052 9:97038698-97038720 GCTCCGGGCGGGCCAGGACCGGG + Intronic
1057708111 9:97412258-97412280 GCTCCGGGCGCGACAGGTGCCGG + Intronic
1060109224 9:120894617-120894639 GCCGGGCGCGGGCCAGGAGCCGG + Intronic
1060945823 9:127568978-127569000 GCGGCGGGAGCGGCGGGAGCGGG - Exonic
1061514664 9:131082011-131082033 GCAGCTGGCTCCACAGGAGCAGG - Intronic
1061606832 9:131717133-131717155 TCAGCGGGCTGGCCAGGAGAGGG - Intronic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1061677557 9:132226965-132226987 GGAGCCGGCCCGCCAGGACCGGG - Exonic
1061840669 9:133356835-133356857 GAAGGGGGCGCGGCAGGAGGGGG + Intronic
1062341558 9:136095717-136095739 GCAGGGCGCGCGCCGGGGGCGGG - Intergenic
1062397647 9:136358841-136358863 GCAGGGGCCTCGACAGGAGCCGG + Exonic
1062400442 9:136370353-136370375 GCTGCGGGACCACCAGGAGCAGG - Exonic
1062556287 9:137114665-137114687 GCAGCCCGAGCGCCAGCAGCAGG + Exonic
1062571439 9:137187560-137187582 ACAGCGGGCTCTGCAGGAGCCGG + Exonic
1203779984 EBV:95941-95963 GGAGCGGGAGGGGCAGGAGCAGG + Intergenic
1203731865 Un_GL000216v2:98775-98797 GGGGCGGGCGCGCCTCGAGCCGG - Intergenic
1189037167 X:37505294-37505316 GCAGTGCGGGCGCGAGGAGCAGG - Intronic
1190297725 X:49038382-49038404 GCAGCAGGCGCGCCGGCAGCAGG - Exonic
1192584095 X:72306550-72306572 GCGGCGTGCGTGCCAGGGGCTGG - Intronic
1195954882 X:110318157-110318179 GCCGGGGGCGCGCCAGAGGCTGG + Exonic
1197941597 X:131795793-131795815 GCAGCAGGTGCGGCAGCAGCTGG - Intergenic
1198031921 X:132761428-132761450 GCAGGGGGCGAGCCAGCACCAGG + Intronic
1198329241 X:135606236-135606258 GCAGGCAGCGTGCCAGGAGCTGG - Intergenic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic