ID: 1160796844

View in Genome Browser
Species Human (GRCh38)
Location 19:949535-949557
Sequence CAGGAGGATGGCTTGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319129
Summary {0: 181, 1: 3199, 2: 18042, 3: 57057, 4: 240650}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796844_1160796857 12 Left 1160796844 19:949535-949557 CCTGGCCTCAAGCCATCCTCCTG 0: 181
1: 3199
2: 18042
3: 57057
4: 240650
Right 1160796857 19:949570-949592 AAAGTGCTGGGATTATAGGCAGG 0: 218
1: 2137
2: 2805
3: 2252
4: 2240
1160796844_1160796858 27 Left 1160796844 19:949535-949557 CCTGGCCTCAAGCCATCCTCCTG 0: 181
1: 3199
2: 18042
3: 57057
4: 240650
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796844_1160796854 8 Left 1160796844 19:949535-949557 CCTGGCCTCAAGCCATCCTCCTG 0: 181
1: 3199
2: 18042
3: 57057
4: 240650
Right 1160796854 19:949566-949588 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1160796844_1160796852 0 Left 1160796844 19:949535-949557 CCTGGCCTCAAGCCATCCTCCTG 0: 181
1: 3199
2: 18042
3: 57057
4: 240650
Right 1160796852 19:949558-949580 CCTCGGCCTCCCAAAGTGCTGGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
1160796844_1160796850 -1 Left 1160796844 19:949535-949557 CCTGGCCTCAAGCCATCCTCCTG 0: 181
1: 3199
2: 18042
3: 57057
4: 240650
Right 1160796850 19:949557-949579 GCCTCGGCCTCCCAAAGTGCTGG 0: 81513
1: 207817
2: 222817
3: 151393
4: 177060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796844 Original CRISPR CAGGAGGATGGCTTGAGGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr