ID: 1160796845

View in Genome Browser
Species Human (GRCh38)
Location 19:949540-949562
Sequence CGAGGCAGGAGGATGGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71022
Summary {0: 21, 1: 534, 2: 4330, 3: 16986, 4: 49151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796845_1160796852 -5 Left 1160796845 19:949540-949562 CCTCAAGCCATCCTCCTGCCTCG 0: 21
1: 534
2: 4330
3: 16986
4: 49151
Right 1160796852 19:949558-949580 CCTCGGCCTCCCAAAGTGCTGGG 0: 120847
1: 270445
2: 211583
3: 123288
4: 170743
1160796845_1160796850 -6 Left 1160796845 19:949540-949562 CCTCAAGCCATCCTCCTGCCTCG 0: 21
1: 534
2: 4330
3: 16986
4: 49151
Right 1160796850 19:949557-949579 GCCTCGGCCTCCCAAAGTGCTGG 0: 81513
1: 207817
2: 222817
3: 151393
4: 177060
1160796845_1160796858 22 Left 1160796845 19:949540-949562 CCTCAAGCCATCCTCCTGCCTCG 0: 21
1: 534
2: 4330
3: 16986
4: 49151
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796845_1160796854 3 Left 1160796845 19:949540-949562 CCTCAAGCCATCCTCCTGCCTCG 0: 21
1: 534
2: 4330
3: 16986
4: 49151
Right 1160796854 19:949566-949588 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1160796845_1160796857 7 Left 1160796845 19:949540-949562 CCTCAAGCCATCCTCCTGCCTCG 0: 21
1: 534
2: 4330
3: 16986
4: 49151
Right 1160796857 19:949570-949592 AAAGTGCTGGGATTATAGGCAGG 0: 218
1: 2137
2: 2805
3: 2252
4: 2240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796845 Original CRISPR CGAGGCAGGAGGATGGCTTG AGG (reversed) Intronic
Too many off-targets to display for this crispr