ID: 1160796847

View in Genome Browser
Species Human (GRCh38)
Location 19:949547-949569
Sequence GGGAGGCCGAGGCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143378
Summary {0: 73, 1: 1998, 2: 65493, 3: 51066, 4: 24748}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796847_1160796857 0 Left 1160796847 19:949547-949569 CCATCCTCCTGCCTCGGCCTCCC 0: 73
1: 1998
2: 65493
3: 51066
4: 24748
Right 1160796857 19:949570-949592 AAAGTGCTGGGATTATAGGCAGG 0: 218
1: 2137
2: 2805
3: 2252
4: 2240
1160796847_1160796854 -4 Left 1160796847 19:949547-949569 CCATCCTCCTGCCTCGGCCTCCC 0: 73
1: 1998
2: 65493
3: 51066
4: 24748
Right 1160796854 19:949566-949588 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1160796847_1160796858 15 Left 1160796847 19:949547-949569 CCATCCTCCTGCCTCGGCCTCCC 0: 73
1: 1998
2: 65493
3: 51066
4: 24748
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796847 Original CRISPR GGGAGGCCGAGGCAGGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr