ID: 1160796848

View in Genome Browser
Species Human (GRCh38)
Location 19:949551-949573
Sequence CTTTGGGAGGCCGAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575717
Summary {0: 27065, 1: 115058, 2: 159548, 3: 160966, 4: 113080}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796848_1160796858 11 Left 1160796848 19:949551-949573 CCTCCTGCCTCGGCCTCCCAAAG 0: 27065
1: 115058
2: 159548
3: 160966
4: 113080
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796848_1160796854 -8 Left 1160796848 19:949551-949573 CCTCCTGCCTCGGCCTCCCAAAG 0: 27065
1: 115058
2: 159548
3: 160966
4: 113080
Right 1160796854 19:949566-949588 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1160796848_1160796857 -4 Left 1160796848 19:949551-949573 CCTCCTGCCTCGGCCTCCCAAAG 0: 27065
1: 115058
2: 159548
3: 160966
4: 113080
Right 1160796857 19:949570-949592 AAAGTGCTGGGATTATAGGCAGG 0: 218
1: 2137
2: 2805
3: 2252
4: 2240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796848 Original CRISPR CTTTGGGAGGCCGAGGCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr