ID: 1160796849

View in Genome Browser
Species Human (GRCh38)
Location 19:949554-949576
Sequence GCACTTTGGGAGGCCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 867824
Summary {0: 84291, 1: 218536, 2: 234154, 3: 158283, 4: 172560}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796849_1160796857 -7 Left 1160796849 19:949554-949576 CCTGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1160796857 19:949570-949592 AAAGTGCTGGGATTATAGGCAGG 0: 218
1: 2137
2: 2805
3: 2252
4: 2240
1160796849_1160796858 8 Left 1160796849 19:949554-949576 CCTGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796849_1160796864 29 Left 1160796849 19:949554-949576 CCTGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796849 Original CRISPR GCACTTTGGGAGGCCGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr