ID: 1160796851

View in Genome Browser
Species Human (GRCh38)
Location 19:949558-949580
Sequence CCCAGCACTTTGGGAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 888921
Summary {0: 114360, 1: 259489, 2: 214307, 3: 130302, 4: 170463}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796851_1160796858 4 Left 1160796851 19:949558-949580 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796851_1160796864 25 Left 1160796851 19:949558-949580 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796851 Original CRISPR CCCAGCACTTTGGGAGGCCG AGG (reversed) Intronic
Too many off-targets to display for this crispr