ID: 1160796853

View in Genome Browser
Species Human (GRCh38)
Location 19:949564-949586
Sequence TATAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 880486
Summary {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796853_1160796864 19 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351
1160796853_1160796869 30 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796853_1160796858 -2 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796853 Original CRISPR TATAATCCCAGCACTTTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr