ID: 1160796853

View in Genome Browser
Species Human (GRCh38)
Location 19:949564-949586
Sequence TATAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796853_1160796864 19 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA No data
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG No data
1160796853_1160796858 -2 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA No data
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG No data
1160796853_1160796869 30 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA No data
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796853 Original CRISPR TATAATCCCAGCACTTTGGG AGG (reversed) Intronic