ID: 1160796855

View in Genome Browser
Species Human (GRCh38)
Location 19:949567-949589
Sequence GCCTATAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855615
Summary {0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796855_1160796864 16 Left 1160796855 19:949567-949589 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351
1160796855_1160796858 -5 Left 1160796855 19:949567-949589 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796855_1160796869 27 Left 1160796855 19:949567-949589 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796855 Original CRISPR GCCTATAATCCCAGCACTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr