ID: 1160796856

View in Genome Browser
Species Human (GRCh38)
Location 19:949568-949590
Sequence TGCCTATAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 816713
Summary {0: 10529, 1: 112818, 2: 243046, 3: 240273, 4: 210047}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796856_1160796858 -6 Left 1160796856 19:949568-949590 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796856_1160796864 15 Left 1160796856 19:949568-949590 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351
1160796856_1160796869 26 Left 1160796856 19:949568-949590 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796856 Original CRISPR TGCCTATAATCCCAGCACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr