ID: 1160796858

View in Genome Browser
Species Human (GRCh38)
Location 19:949585-949607
Sequence TAGGCAGGAGCCGCCGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24985
Summary {0: 1, 1: 1, 2: 56, 3: 1920, 4: 23007}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796856_1160796858 -6 Left 1160796856 19:949568-949590 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796847_1160796858 15 Left 1160796847 19:949547-949569 CCATCCTCCTGCCTCGGCCTCCC 0: 73
1: 1998
2: 65493
3: 51066
4: 24748
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796844_1160796858 27 Left 1160796844 19:949535-949557 CCTGGCCTCAAGCCATCCTCCTG 0: 181
1: 3199
2: 18042
3: 57057
4: 240650
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796848_1160796858 11 Left 1160796848 19:949551-949573 CCTCCTGCCTCGGCCTCCCAAAG 0: 27065
1: 115058
2: 159548
3: 160966
4: 113080
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796853_1160796858 -2 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796845_1160796858 22 Left 1160796845 19:949540-949562 CCTCAAGCCATCCTCCTGCCTCG 0: 21
1: 534
2: 4330
3: 16986
4: 49151
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796849_1160796858 8 Left 1160796849 19:949554-949576 CCTGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796855_1160796858 -5 Left 1160796855 19:949567-949589 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007
1160796851_1160796858 4 Left 1160796851 19:949558-949580 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG 0: 1
1: 1
2: 56
3: 1920
4: 23007

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796858 Original CRISPR TAGGCAGGAGCCGCCGCCCC TGG Intronic
Too many off-targets to display for this crispr