ID: 1160796864

View in Genome Browser
Species Human (GRCh38)
Location 19:949606-949628
Sequence GGCCTTTCCCCTCCCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 351}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796855_1160796864 16 Left 1160796855 19:949567-949589 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351
1160796851_1160796864 25 Left 1160796851 19:949558-949580 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351
1160796853_1160796864 19 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351
1160796856_1160796864 15 Left 1160796856 19:949568-949590 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351
1160796849_1160796864 29 Left 1160796849 19:949554-949576 CCTGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG 0: 1
1: 0
2: 1
3: 47
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796864 Original CRISPR GGCCTTTCCCCTCCCTCCAG TGG Intronic
900392702 1:2440619-2440641 GGCCTTGCCCGGCCCGCCAGGGG + Intronic
900621569 1:3590045-3590067 GGCCCTGCCTCTCCGTCCAGTGG + Intronic
900952121 1:5864033-5864055 TCCCTGTCCCCTCCCTCCACAGG - Exonic
901631686 1:10651148-10651170 GCCCACTGCCCTCCCTCCAGGGG - Intronic
901837077 1:11931170-11931192 GGCATTTCCTCTTCCTCCAGGGG + Intergenic
902442546 1:16440556-16440578 AGGCTTCTCCCTCCCTCCAGAGG - Intergenic
903631814 1:24780033-24780055 CCCCTTTCCCCTCCCACCAGTGG + Intronic
903753115 1:25642165-25642187 GGCCATCGCCCTCCCTCCTGTGG + Intronic
904586527 1:31583991-31584013 GGCTTCTCCCTTCCCACCAGTGG + Intronic
904604286 1:31690462-31690484 GACCTAGCCCCTCCCTCCAGAGG + Intronic
904675557 1:32197230-32197252 GGCCTTTCCCCTCTCTTCAAGGG - Exonic
904950549 1:34234884-34234906 TGCCTTTCACCTCTCACCAGAGG + Intergenic
905017218 1:34786031-34786053 GGCATCTCTACTCCCTCCAGAGG + Exonic
905395010 1:37661281-37661303 GGCCTCACCTCTCCCTCCATGGG + Intergenic
905586086 1:39119734-39119756 TGCTTTTCCCGTCCATCCAGTGG + Intronic
906139187 1:43523385-43523407 GGCCTTTCCCCTTCTTACTGTGG - Intergenic
906518290 1:46452469-46452491 GGCCATTCCCCTGCCTCCCATGG + Intergenic
906518409 1:46452989-46453011 GGCCCTACCCCTCCCTCCAAGGG - Intergenic
906655930 1:47548346-47548368 CTCCTTTCCCCTGCCCCCAGAGG + Intergenic
907650930 1:56294156-56294178 GTCTCTTCCCCTCCCTCCAGTGG + Intergenic
909113622 1:71508323-71508345 GTCTTTTTCCCTCCCTCCTGGGG - Intronic
911614434 1:99992945-99992967 GCCCTTCCCCCTCCCACTAGGGG - Intronic
912497685 1:110102025-110102047 GGGATCTCCCCTCCCTCCTGGGG + Intergenic
912905275 1:113699157-113699179 GGCCTCATCCCTGCCTCCAGGGG - Intronic
913332068 1:117676020-117676042 GGCCTTGTCATTCCCTCCAGTGG - Intergenic
914845399 1:151281292-151281314 TCCCTTTCCCCCGCCTCCAGGGG + Intronic
915297086 1:154929083-154929105 GGCGTTTCTCCTCTCCCCAGCGG + Exonic
915513736 1:156400946-156400968 AGCCTCTCCTCTTCCTCCAGTGG - Intergenic
915520515 1:156439749-156439771 GGCCCTGCCCCTCCCTCCCCAGG + Intergenic
915729567 1:158043586-158043608 CGCCTTTCCTCTCCACCCAGTGG + Intronic
919483096 1:198113346-198113368 TACCTTTTCCCTCCTTCCAGGGG - Intergenic
919768883 1:201144527-201144549 TGGCTTTCCCCTCCCTGCAGAGG - Intronic
919833218 1:201556515-201556537 GGCCCTTCCTGCCCCTCCAGGGG - Intergenic
920838205 1:209531580-209531602 AGCCTTTCCTCTCATTCCAGAGG - Intergenic
922731680 1:227951836-227951858 GCCCAGTCCCCTCCATCCAGCGG - Intergenic
923551193 1:234965319-234965341 AGCTCTTGCCCTCCCTCCAGGGG + Intergenic
924831940 1:247605575-247605597 GCCCAATCCCATCCCTCCAGGGG - Exonic
924942383 1:248821121-248821143 GGCTATCCCCCTCCCTCCTGTGG - Intronic
1065295998 10:24275926-24275948 TTCCATACCCCTCCCTCCAGTGG + Intronic
1065822225 10:29536247-29536269 TGCCTCTCTCCTCCCTCAAGTGG - Intronic
1067232444 10:44421556-44421578 TGCCTGTCACCTCCTTCCAGGGG + Intergenic
1067455574 10:46417078-46417100 GGACTCTCCCCTCCCTCCCGGGG - Intergenic
1067631629 10:47967561-47967583 GGACTCTCCCCTCCCTCCCGGGG + Intergenic
1069490521 10:68856820-68856842 GTCCCTTCCCCTCCCACCTGGGG + Intronic
1069928602 10:71868250-71868272 GCCCCTTCCACTCCCTCCTGGGG + Intergenic
1070747019 10:78939836-78939858 GCCCTCTTCCTTCCCTCCAGTGG + Intergenic
1070919787 10:80177346-80177368 GGACCTTCATCTCCCTCCAGTGG + Intronic
1071667916 10:87578316-87578338 GGCTTTTCCTCTCCCTCTGGTGG + Intergenic
1071778447 10:88815565-88815587 GGCATTAGCTCTCCCTCCAGGGG - Intronic
1071812711 10:89200615-89200637 GCCCTTTCCACTCCTTCTAGGGG + Intergenic
1072612890 10:97030903-97030925 GGCCTGTCCCCTCTCTGCAGAGG - Intronic
1073469523 10:103714191-103714213 GGGCTTACCCCTTCCGCCAGAGG + Intronic
1073473528 10:103738578-103738600 GGCCCTCCCCCACCCTCCTGTGG - Intronic
1075086662 10:119418417-119418439 GGCCTTTCTCATCCAGCCAGAGG + Intronic
1075264039 10:120985727-120985749 GGCATTTTCCCTGCCTCCTGGGG + Intergenic
1076291499 10:129349268-129349290 GGCCCTTGCCTGCCCTCCAGAGG - Intergenic
1076735442 10:132456991-132457013 GACCTTTGCACTCACTCCAGCGG + Intergenic
1076760931 10:132605409-132605431 CCCCTTTCCCATCCCTCCTGGGG - Intronic
1077149391 11:1062808-1062830 GCACGTTCCCCTCCCTCCTGAGG - Intergenic
1077610963 11:3642795-3642817 GGCCTTTCCCCCACCTCCTCTGG + Intergenic
1078093659 11:8283600-8283622 GGCCCGTCCCCTCCCCCCAGTGG + Intergenic
1081590610 11:44420436-44420458 AGCCCTTCCCCTTACTCCAGTGG + Intergenic
1082556944 11:54574175-54574197 TGCCTGTGCCCTGCCTCCAGAGG - Intergenic
1082867627 11:57914150-57914172 GCCCTTTCCCCTTCCACCAAGGG - Intergenic
1083477057 11:62921536-62921558 GTCCTTTCTCCTCCCTCTTGGGG - Exonic
1084046127 11:66568563-66568585 GGCCTGAGTCCTCCCTCCAGCGG + Exonic
1084358349 11:68653822-68653844 GGCCCTGCTCCTGCCTCCAGAGG - Intergenic
1084364517 11:68688770-68688792 GGTCATCCCCCTCCCTACAGAGG - Intronic
1084592413 11:70098324-70098346 GGGCTTTCCCCTGCACCCAGTGG + Intronic
1084792756 11:71485191-71485213 GGCCTCTCCCCTCCTGCCAGTGG + Intronic
1088753206 11:112863474-112863496 GCCCATCCCCATCCCTCCAGTGG + Intergenic
1089365656 11:117919479-117919501 GGCCCTGCCCTTCCCTCCTGGGG + Intronic
1089498276 11:118918661-118918683 TTTCATTCCCCTCCCTCCAGAGG - Intronic
1089685835 11:120146304-120146326 GGTTTTTCCCCTCCATCCATTGG - Intronic
1091095842 11:132821385-132821407 GGTCTCTGCCCTCCTTCCAGAGG - Intronic
1091218083 11:133915855-133915877 TGGCTTTCCCCTGCCTCCATCGG - Intronic
1091231070 11:133988395-133988417 GGCCTTTCCCCTGCCTTATGTGG - Intergenic
1091237399 11:134031334-134031356 TGCCTTTCCCCTTCATCCTGGGG - Intergenic
1094547666 12:31420007-31420029 AGCATTTCCACTCCCTTCAGTGG + Intronic
1095974472 12:47929783-47929805 TGCCTTTCCACCCCCACCAGAGG + Intronic
1096241700 12:49963183-49963205 GGCATTTACCCTCCATCCTGTGG - Intronic
1096334939 12:50747474-50747496 GGGCTCTCCTCTCCCTCCACAGG - Exonic
1096534661 12:52263670-52263692 GTCATTTCTCCTCCCTCCTGGGG - Intronic
1096627638 12:52905103-52905125 GGCCTTTCCCCCCCATCCCCCGG - Intronic
1096668214 12:53180972-53180994 GGCCTTTCCCCTCCCTCCCCCGG - Intronic
1096975702 12:55698322-55698344 GGGCTTCCCCATCCCTCCTGTGG + Intronic
1097170853 12:57111738-57111760 GGACTCTGCGCTCCCTCCAGTGG + Intronic
1097341639 12:58444881-58444903 AACCCTTCCCCTCCCTCCTGGGG - Intergenic
1100048265 12:90411307-90411329 GGCCTGCCCCCTACCTCCCGGGG - Intergenic
1101767086 12:107711573-107711595 GGCCACTCCTCTCCCTTCAGGGG + Intronic
1102481943 12:113229853-113229875 GGACTTTCCCATCCCTCTATGGG + Intronic
1102564024 12:113782981-113783003 ATCCTCTCCCCTCCCTCCCGCGG + Intergenic
1102645347 12:114400162-114400184 CGGCCTTCCCCTTCCTCCAGCGG - Intronic
1103900080 12:124298993-124299015 GGCCTCTCCCGGCCCTCCGGTGG - Intronic
1103906247 12:124328565-124328587 GGCCTTTGCACACCCCCCAGAGG + Intronic
1105603796 13:21910209-21910231 GGCCTTTGCTCTCCCTCAGGAGG - Intergenic
1105771872 13:23619801-23619823 GGCCTTTCCCCACCCTCCCTGGG - Intronic
1105805831 13:23951138-23951160 AGCCTTTCCACCCTCTCCAGAGG + Intergenic
1105939789 13:25137455-25137477 GGCCATTCCCCTGCCTGCCGCGG - Intergenic
1106786021 13:33108738-33108760 TGCCTCCTCCCTCCCTCCAGAGG - Intronic
1107608482 13:42087148-42087170 GGCCTTTCCACTCTGTCCAGTGG - Intronic
1108171471 13:47746177-47746199 GGCATTTCCCCATCCTCCTGTGG + Intergenic
1109966478 13:69704753-69704775 TGCCTTTGTTCTCCCTCCAGGGG + Intronic
1112486780 13:99827317-99827339 GTCCTTTCCCCACCCCTCAGGGG - Intronic
1113709471 13:112454163-112454185 GGCCTGAACCCTCACTCCAGGGG - Intergenic
1114528749 14:23382159-23382181 GGCCCTGCCTCTCCCTCCAAGGG - Intronic
1115722563 14:36178624-36178646 GCCCATTCCCCTCCCTCCCAGGG - Intergenic
1117751812 14:58931133-58931155 TGCCTTTCCCCTCCCACCATAGG - Intergenic
1121118911 14:91363792-91363814 GGCCTTTGCCCTCCCCCGCGGGG + Intronic
1122302674 14:100739830-100739852 AGCCTTCCCCCTCCCTCGAAGGG - Intergenic
1122359674 14:101151808-101151830 GGCCTCTCCACGCCTTCCAGAGG + Intergenic
1122540117 14:102493410-102493432 GGCCTCTCCCCTCCCTTCCCTGG + Intronic
1122540523 14:102495506-102495528 GGCCTCTCCCCTCCCTTCCCTGG - Intronic
1122763054 14:104044047-104044069 GCCCTGTCCCATCCCTGCAGTGG - Intronic
1122921024 14:104880197-104880219 AGCCTCTCCTCTCCATCCAGAGG - Intronic
1124592644 15:31066932-31066954 AGCCTTTCCCATTCCTCCAATGG - Intronic
1124794264 15:32761760-32761782 GGCCTTTCCCGTTCCTCTAGGGG - Intergenic
1125277972 15:38013306-38013328 GTCCTTTTCCCTCCTTCCTGTGG - Intergenic
1125684791 15:41557982-41558004 CCCCTTGCCCTTCCCTCCAGGGG - Intronic
1126112876 15:45185978-45186000 GGCCCTTCTCCTCTCTACAGTGG - Intronic
1126584127 15:50266347-50266369 AGTGTTTCCCCTCCCTACAGGGG - Intergenic
1126664875 15:51067278-51067300 GTCCCTTCCCAACCCTCCAGAGG + Intronic
1126954818 15:53921078-53921100 AGCCTTTCCCCTCCTACCACAGG - Intergenic
1127296168 15:57610505-57610527 GGTCTCTCCCCATCCTCCAGGGG - Intronic
1128028108 15:64456382-64456404 GTCCTTTCCCCTTTCTCCAGAGG - Intergenic
1128082847 15:64866458-64866480 GGCCTCTCATCTCCCTCAAGAGG - Exonic
1128577660 15:68787379-68787401 GGACCCTCCCCTCCCTGCAGGGG - Intronic
1129119645 15:73388268-73388290 GCCCCTTCCGCACCCTCCAGTGG - Intergenic
1129391994 15:75225297-75225319 GGCCTTTCTTCTCCCTCCCCCGG - Intergenic
1129472381 15:75762865-75762887 GGCCTTTCTTCTCCCTCCCCCGG + Intergenic
1129540895 15:76346487-76346509 GGCCTTTCGCCTCCGCCCAGCGG + Intergenic
1130270873 15:82446128-82446150 GGCCTTTCCCCTTCCCTCACTGG - Intergenic
1130463213 15:84173451-84173473 GGCCTTTCCCCTTCCCTCACTGG - Intronic
1130489461 15:84421337-84421359 GGCCTTTCCCCTTCCCTCACTGG + Intergenic
1130501052 15:84500099-84500121 GGCCTTTCCCCTTCCCTCACTGG + Intergenic
1130716928 15:86343899-86343921 TGCCTTTCCCCTTCCTCAAATGG + Intronic
1131594609 15:93784347-93784369 GGCCCTGCCTCTTCCTCCAGGGG - Intergenic
1132116016 15:99137061-99137083 GTCCCTTCCCCTCCCTCCCCTGG - Exonic
1132584743 16:701193-701215 AGCCTGTCCCCTCCCTCCTGTGG - Intronic
1132827996 16:1914421-1914443 GGTCTTTCCCCTCCCAGCACTGG - Intronic
1134045607 16:11098809-11098831 AGCCTTTCCCACCCCTCCACTGG + Intronic
1134447855 16:14344327-14344349 GGCCATTCCCTTCCCTCCGTGGG + Intergenic
1134537726 16:15040195-15040217 GGACTTCCCCCTCCCTGGAGGGG + Intronic
1135107720 16:19664982-19665004 TGCTTTTCCCCTTCCTCTAGTGG + Intronic
1136026016 16:27469606-27469628 AGCCTCTCCCCTCCCTCAAGAGG + Intronic
1136362642 16:29790743-29790765 GGCCATTCCACTCCCTCCTTGGG - Exonic
1136624932 16:31456610-31456632 GGCCCTTCCCTTCCCTGCTGGGG - Intergenic
1137002422 16:35240953-35240975 GGCCTTTGGCCTACCTCCTGAGG + Intergenic
1137760426 16:50935777-50935799 GGCCTTTGCCCTCTCTCCTCTGG - Intergenic
1137791232 16:51176427-51176449 TGGCTGTCCCCTCCTTCCAGAGG + Intergenic
1138539984 16:57682276-57682298 GTCCTGTCCCCTGCCTCCTGGGG + Intronic
1139512214 16:67433979-67434001 GGCCTTTCCCCTTCCCTCACTGG + Intronic
1139589035 16:67923077-67923099 GGGCTTTCCGCTCCCGCCTGAGG - Intronic
1141414596 16:83860630-83860652 GACCTCTCCCCTCAATCCAGCGG - Intergenic
1141632720 16:85297176-85297198 TTCCTCTTCCCTCCCTCCAGAGG + Intergenic
1141685102 16:85565676-85565698 GGCCTGTTCTCTCACTCCAGTGG - Intergenic
1141720831 16:85754379-85754401 TGCCTTTCCCCGCACTCCAGGGG - Intergenic
1141804091 16:86331195-86331217 GCCCTCTCCGCTCCTTCCAGAGG - Intergenic
1142287669 16:89177984-89178006 GGCCTTGGGCCTCCCTCCTGGGG - Intronic
1143034587 17:3987141-3987163 GGCCCTTCCCCTTCGGCCAGTGG + Intergenic
1143091212 17:4450057-4450079 GGCCTCCTCCCTGCCTCCAGGGG + Intronic
1143186658 17:5014177-5014199 TGCCCTTCCCCTCCCACCACAGG + Intronic
1143412687 17:6721151-6721173 GTCCTTTTTCCCCCCTCCAGAGG + Intergenic
1143480780 17:7226313-7226335 TGCCCCTCCCCTCCCTCCACAGG - Exonic
1143523981 17:7462083-7462105 GGCCCTTCCCTTCCTACCAGGGG - Exonic
1143569015 17:7742874-7742896 GGCCTGCCACCTTCCTCCAGGGG - Intronic
1144066266 17:11627105-11627127 GGCCTTTCCTCACCCTTCTGTGG - Intronic
1144443288 17:15303544-15303566 GGCCTTTCCCCTTCTTACTGTGG + Intergenic
1144718850 17:17453871-17453893 GGCCTCTCCCCTCACTCCGCGGG + Intergenic
1145124143 17:20286555-20286577 GACTTTTCACCTCCATCCAGGGG + Intronic
1145297373 17:21602040-21602062 GGCCATTTCCCAACCTCCAGGGG + Intergenic
1145366572 17:22270825-22270847 GGCCATTTCCCAACCTCCAGGGG - Intergenic
1146955439 17:36934408-36934430 GGCCTGTCACCTCCCTCTGGTGG - Intergenic
1147324424 17:39663508-39663530 TGCCTTTCTCTTCCCTCAAGAGG - Intergenic
1148156565 17:45428116-45428138 GGCCATTCCCCCACCTCCAGGGG + Intronic
1148578007 17:48724930-48724952 GGCCTTTTTCCTCTCTCCAAGGG + Exonic
1149599619 17:57885158-57885180 GGCCGTGCCCCTACCTCCGGGGG + Intronic
1149988873 17:61369263-61369285 GGCCTCTTCCCTCCTTTCAGAGG + Intronic
1150388250 17:64776765-64776787 GGCCATTCCCCCACCTCCAGGGG + Intergenic
1150791205 17:68201190-68201212 GGCCATTCCCCCACCTCCAGGGG - Intergenic
1151235825 17:72719290-72719312 AGCATTTCCCCTGCCTCCCGAGG + Intronic
1151366069 17:73617228-73617250 GGCCTCTCCCCTCCCCTCTGCGG - Intronic
1151479487 17:74361841-74361863 GGGCTTCACCGTCCCTCCAGTGG - Exonic
1151801508 17:76382432-76382454 TGCCCTTCGCCTCCCTCCCGCGG + Intronic
1151820798 17:76495766-76495788 GGCATTTTCCCTCCCTGCTGAGG - Intronic
1152104924 17:78323277-78323299 GGTCTGTTTCCTCCCTCCAGGGG - Intergenic
1152424005 17:80209170-80209192 GGCCTTGCCCCTGCCTCCTGGGG + Exonic
1152457845 17:80426304-80426326 TGTCCTTCCCCTTCCTCCAGCGG - Intronic
1152608015 17:81302709-81302731 GGGCCCTCCCCTCCCTCCATGGG - Intergenic
1152740931 17:82018047-82018069 ACCCTTTCCCCTCCCTGCACGGG + Intergenic
1153457214 18:5295262-5295284 GGCCCTCCCCCGCCCTCCCGCGG + Intronic
1153691556 18:7599740-7599762 GGCCTTTGCTTTCCCTCAAGAGG - Intronic
1153824748 18:8865135-8865157 TGCCTTTCCCCTCCCTGCCAAGG + Intergenic
1156488161 18:37479681-37479703 GGCCTTTATCCTCCCTACTGTGG + Intronic
1156859390 18:41818498-41818520 GGCCTTCCCCTTCCCCCCACAGG + Intergenic
1157296251 18:46447405-46447427 AGCCTTTCCTCTCTCTTCAGAGG - Intronic
1157557419 18:48621905-48621927 GGCCTATCCCCAGCCCCCAGCGG + Intronic
1157803263 18:50638074-50638096 GGTCCTTCCCCTCTCTCCACTGG + Intronic
1160605008 18:80043642-80043664 TGCCTATCCCCTGCCTCCGGGGG - Intronic
1160796864 19:949606-949628 GGCCTTTCCCCTCCCTCCAGTGG + Intronic
1160868958 19:1268390-1268412 GGCCTTTTCTCTCCTTCCACAGG - Intronic
1161369621 19:3903397-3903419 GGCCCTTTCCCTGCCTCCGGAGG - Intronic
1161461413 19:4400089-4400111 TGCCTCTCCCCTCCTCCCAGGGG + Intronic
1162026128 19:7895094-7895116 GGCCCCTCCACCCCCTCCAGGGG - Intronic
1162344944 19:10113508-10113530 GTTCTTTCCCCTCCCTGGAGGGG - Intronic
1162534108 19:11253149-11253171 TGCCCTGCCCCTCCCTCCAGGGG + Intronic
1162966421 19:14158307-14158329 AGCCGTCCCCCTCCCTCCATGGG - Intronic
1163462763 19:17448688-17448710 GTCTTTTCTCCTCCCTCCCGGGG + Intronic
1163677072 19:18660559-18660581 GGTCCTTCCCCTCCTCCCAGTGG + Intronic
1167247655 19:48383367-48383389 AGGCTGTCCCCTCCCTGCAGGGG - Intronic
1168186840 19:54705541-54705563 GGCCAGGCCCCTCCCTCCACAGG - Intergenic
1168349349 19:55667211-55667233 GGCATCTCCCCTCCTTCCATGGG + Intronic
925743952 2:7029314-7029336 TGCCATTCCCCTCACGCCAGTGG + Intronic
925844125 2:8020417-8020439 GGCCTGGCCCCTCCCTACAAGGG - Intergenic
926275480 2:11400097-11400119 GCCCTTTCCCCACCCTGTAGAGG - Intergenic
926928973 2:18017454-18017476 GGCCTGTGCCCTGCCCCCAGAGG + Intronic
927709377 2:25315267-25315289 GGCCTAGCCCCTTTCTCCAGGGG + Intronic
927851591 2:26503323-26503345 GGCCCTGCCGCGCCCTCCAGCGG + Intronic
929298074 2:40270975-40270997 GGCCTATGCCCTCTCTCCTGAGG + Intronic
930061803 2:47295835-47295857 AGCCTTTGCCCTCCCCACAGAGG - Intergenic
931585049 2:63816959-63816981 GTCCTTACCCCTGCCCCCAGAGG - Intronic
935182856 2:100705836-100705858 GGCCTTTCCCCCAACCCCAGTGG + Intergenic
935397187 2:102620647-102620669 GCCCTTTCTCCTCCCTCTATTGG + Intronic
936473264 2:112817327-112817349 AGCCCCTCCACTCCCTCCAGTGG + Intergenic
936510051 2:113137946-113137968 GGCCTACCTCCTCCATCCAGAGG + Intergenic
937011363 2:118565551-118565573 GGGCTTTCTCCTCCCACTAGCGG - Intergenic
937470768 2:122172202-122172224 GGACCTTCCCCTTCCTCCAGAGG - Intergenic
938116904 2:128608421-128608443 GGCCTTTCCCAGCCCAGCAGGGG + Intergenic
938343338 2:130549598-130549620 GCCCTCTCCCCTCCTTCCAAAGG + Intronic
938346495 2:130571124-130571146 GCCCTCTCCCCTCCTTCCAAAGG - Intronic
938629020 2:133144818-133144840 AGCCTCTGCTCTCCCTCCAGTGG - Intronic
938961891 2:136351584-136351606 GGCCTCTCCTCTCCCTAGAGGGG + Intergenic
938980461 2:136521372-136521394 TGCCCCTCTCCTCCCTCCAGTGG - Intergenic
941042149 2:160634692-160634714 TTCCTTGCCCCTCCCTCCAATGG + Intergenic
945790069 2:214293757-214293779 GGCCTTCCATCTCCCTCCTGTGG + Intronic
945985790 2:216352462-216352484 GGCCTTTCCCTTCCTCCCAGGGG + Intronic
946621492 2:221568710-221568732 GGACTTACCCCTCCTTCCAGAGG + Exonic
947461612 2:230308631-230308653 GGGCTGTCCCCTGCTTCCAGAGG + Intronic
947824404 2:233094817-233094839 GGCATTTGCACTCCCTCCCGTGG - Intronic
947846027 2:233244379-233244401 GCCCCTTCCCCTCCATCCAAAGG + Intronic
948777949 2:240299538-240299560 AGCCCATCCTCTCCCTCCAGGGG + Intergenic
948825301 2:240570977-240570999 GGCCTTGCCTCACCCTCCTGAGG - Intronic
949022962 2:241751860-241751882 GGCCTTGCCCCTCCTTCCTTTGG - Intronic
1169044032 20:2521481-2521503 GGCCCTACTTCTCCCTCCAGAGG - Intronic
1169046547 20:2538060-2538082 GCCCTTTCCACTCCCTCCTGTGG + Intronic
1171530449 20:25849653-25849675 GGCCTTTCCCTCCCCTAGAGAGG - Intronic
1172073720 20:32277924-32277946 GGCCTTGCCCCTCCTTCCCCTGG + Intronic
1172222722 20:33284791-33284813 GCTCTGTCCCCTCCCTCCACAGG - Intronic
1174050803 20:47766097-47766119 ACACTTTCCCATCCCTCCAGGGG - Intronic
1174409108 20:50322132-50322154 GGCCAGCCCCCTCTCTCCAGGGG + Intergenic
1174705625 20:52653040-52653062 CCCCTTTCCCCTCCCTGGAGGGG + Intergenic
1175184385 20:57170146-57170168 GGCTTTTCACCTCGCCCCAGTGG - Exonic
1175551361 20:59820006-59820028 TGACTTTCCCAGCCCTCCAGGGG + Intronic
1175704293 20:61164659-61164681 GGTCTTGCCCCTCCATGCAGGGG + Intergenic
1175940693 20:62536305-62536327 TGCCCTTCCCTCCCCTCCAGGGG + Intergenic
1175946310 20:62560697-62560719 GGCCCCTCCCCTCCCACCAGGGG - Intronic
1176196281 20:63837534-63837556 GGCCCGTCCCCTTCCACCAGAGG + Intergenic
1176521801 21:7829922-7829944 GGCCTTTCTCCTGGCTGCAGTGG - Intronic
1178655821 21:34459934-34459956 GGCCTTTCTCCTGGCTGCAGTGG - Intergenic
1179999223 21:44987579-44987601 GTCCCTGCCCCTCCCTCCCGTGG + Intergenic
1180877503 22:19181553-19181575 GGCCTGTACCCTCCCTACAATGG + Intronic
1181168638 22:20996216-20996238 GGCCCAGCGCCTCCCTCCAGAGG + Intronic
1181461169 22:23086727-23086749 TGCATTTCCCCTCTCTCCAGTGG - Intronic
1181516246 22:23415255-23415277 GGCCTTCCCCCTCCCACCTACGG - Intergenic
1181527952 22:23500926-23500948 GGCCCCTCCCCTCCTTCCTGGGG + Intergenic
1182009727 22:26990345-26990367 GGCCCTTTCACACCCTCCAGAGG + Intergenic
1182736661 22:32535883-32535905 GGCCTGACCCCGCCCTCCACTGG - Intronic
1183364702 22:37400662-37400684 GGCCATGTCCTTCCCTCCAGGGG - Intronic
1183430976 22:37765596-37765618 GGCCCTTCCCCAGCCTCCAGAGG - Intronic
1183484447 22:38081733-38081755 GGCCTGGCCCCTCCCTCCTGTGG - Intronic
1183991293 22:41598669-41598691 GGGGTCTCCCCTCCATCCAGGGG - Exonic
1184273567 22:43398177-43398199 GGCCTTGGCCCTCCTTCCAGGGG - Intergenic
1184458749 22:44625586-44625608 GGCCAGTCCCCACCCACCAGCGG - Intergenic
949930069 3:9071494-9071516 AGCCTCTCCCCACCCTCCAGTGG - Intronic
950099743 3:10349531-10349553 AGTCTTGCTCCTCCCTCCAGAGG - Intronic
950138431 3:10599406-10599428 AAGCTTTCCCCTCCCTGCAGGGG + Intronic
950138694 3:10600792-10600814 AACCTTTTCCCTCCCTGCAGAGG + Intronic
950440472 3:13007389-13007411 GGCCTCTGCCCTCCTCCCAGGGG - Intronic
950479814 3:13237296-13237318 GGCCTGTCCCCACCTTCCACAGG - Intergenic
950767774 3:15286213-15286235 GGCCATTCCCATCCTTCCACAGG - Intronic
952881981 3:37991114-37991136 CTCCTTTCCCCTCACTCTAGAGG + Intronic
953040381 3:39250739-39250761 GGCCTTTCCCCTTCCTGGAAGGG + Intergenic
953746721 3:45580024-45580046 GGCCTCTCACCTTCCACCAGAGG + Intronic
954469052 3:50675540-50675562 GGCCTTGCCCACCCCTCCCGCGG - Intronic
954662125 3:52231825-52231847 GCTCTTCCCCCACCCTCCAGGGG + Intronic
954807961 3:53231265-53231287 TCCCTTTCCCAGCCCTCCAGAGG + Intronic
955014110 3:55051561-55051583 TGTCTGTGCCCTCCCTCCAGAGG + Intronic
955935034 3:64094744-64094766 GGCCTTTGCCTTGTCTCCAGTGG - Exonic
956175739 3:66471531-66471553 AGCCTTTGCTCTCCCTGCAGCGG - Intronic
957555626 3:81761698-81761720 GCCCTTTCTCCCCCCGCCAGCGG + Exonic
958742873 3:98095999-98096021 GGTCTATGCCCTGCCTCCAGAGG + Intergenic
961555035 3:127691505-127691527 TGCCCTTCCCCTCCTGCCAGGGG - Exonic
963874901 3:150464019-150464041 CACCTTTCCCTTCCCTCCAAGGG - Exonic
964344638 3:155744107-155744129 GCCCTCTCCCCTCCTTCCCGAGG - Intronic
964819441 3:160754925-160754947 GGCCCTTCTCGTCCCTCCCGAGG + Intergenic
965905443 3:173699826-173699848 GAGCTTTCCCCTCCCACCAGTGG + Intronic
967041925 3:185701952-185701974 GGCCTGTCCCCTCCTTCCCCGGG + Intronic
969109034 4:4829757-4829779 GGCCTTTCCTCATCCTCAAGGGG + Intergenic
969689292 4:8695244-8695266 GGCCTTTCACCTGCCTCCGTGGG + Intergenic
969710236 4:8839108-8839130 GGCCTTTCCCGTCCCGCATGAGG - Intergenic
971294606 4:25377283-25377305 GGCCTCTCCCCTCCCTCTGCCGG - Exonic
972704648 4:41530415-41530437 GAACTTTACCTTCCCTCCAGTGG + Intronic
973855475 4:55006648-55006670 GACCCTCCCCCTCCCTCCATTGG + Intergenic
977758709 4:100704828-100704850 TGCCTTTCCCCTTCCACCATGGG - Intronic
978110164 4:104953817-104953839 AGCCTTTCTCCTCTCTCCAGGGG + Intergenic
978476234 4:109134476-109134498 GGGCTTTCCACTCCCTCTAAAGG + Intronic
985635498 5:1033829-1033851 GCCCTGTGCCCTGCCTCCAGCGG - Intronic
986457436 5:7933501-7933523 GGCCTTCCCCATAGCTCCAGTGG + Intergenic
987478354 5:18420672-18420694 TGCATTTCCTCTCCCTCCACAGG - Intergenic
989578054 5:43007255-43007277 TGGCTTTCTCCTCCCTCCTGGGG - Intergenic
993961947 5:94308830-94308852 GGCCGTTTTCCTCCTTCCAGAGG + Intronic
997206859 5:132055248-132055270 GGCCCTTCCCCTCTCTCCCTGGG + Intergenic
997440797 5:133907431-133907453 GGCCTTCCACCTTCCCCCAGAGG + Intergenic
998157124 5:139793388-139793410 TTCCTTTCCCCTCCGTCAAGTGG - Intergenic
998833416 5:146182559-146182581 TACCTTTCCCCTCCCTCTCGGGG + Exonic
1000004927 5:157174894-157174916 AGCCATTCCCCTACCTCTAGTGG + Intronic
1000961910 5:167610376-167610398 AGCCCTTCTCCTCTCTCCAGGGG + Intronic
1001818932 5:174694537-174694559 TACCTGTCCCCTCCCTCCTGAGG + Intergenic
1002976809 6:2087082-2087104 GGCCTTTCCACTCCCACCACAGG + Intronic
1003095423 6:3139512-3139534 GGCCTTTCCCTCCTCTTCAGTGG - Intronic
1003130701 6:3393000-3393022 TTCCTTTGCCCTCCCTCCAAAGG - Intronic
1003368492 6:5500483-5500505 GGCCTTGCCCCACCCTCCGCTGG - Intronic
1003613390 6:7632997-7633019 AACATTTCCCCTCTCTCCAGGGG + Intergenic
1005152246 6:22765597-22765619 GGCCTTTCCTCACCATCCAAGGG + Intergenic
1005959350 6:30684800-30684822 GCCCTCCCCCCTCCCACCAGAGG - Exonic
1006271578 6:32970203-32970225 GCCTTTTCCCCTCCCCCTAGCGG - Intronic
1006276701 6:33009821-33009843 GGCCTTTTCTCTCTCTTCAGGGG - Intergenic
1006363389 6:33599967-33599989 AGACATTCCCTTCCCTCCAGAGG - Intergenic
1007451346 6:41941913-41941935 GCGCTCTCCCCTCCCTCCCGCGG + Intronic
1010083272 6:71887366-71887388 GGCATATCCCCTCCCTCCTCCGG - Intronic
1012016778 6:93862723-93862745 AGGCTTTCCACTCCCTCCGGAGG + Intergenic
1013033841 6:106361164-106361186 GGGCTTTCCCCTCCTCCAAGTGG - Intergenic
1013575876 6:111483227-111483249 CCCCTCTCCCCTCCCCCCAGTGG - Exonic
1014156049 6:118110901-118110923 GGCTTTTTCCCTTCCTCCAGGGG + Intronic
1015818103 6:137230921-137230943 GACCTCACCCCTCACTCCAGGGG - Intergenic
1017227345 6:152037411-152037433 AACCTTTCCACTCCATCCAGAGG - Intronic
1018908437 6:168088429-168088451 GACTTTTCCCCTCCACCCAGAGG + Intergenic
1019572674 7:1720246-1720268 GGCCTCTGCCCTTACTCCAGTGG + Intronic
1021592786 7:22282102-22282124 AGCCATTCCCCCCTCTCCAGCGG + Intronic
1022526065 7:31038120-31038142 GGCCATACCCCTCCCTTCAGAGG + Intergenic
1023558655 7:41449534-41449556 GATCTTTCCCCTACTTCCAGTGG - Intergenic
1023638637 7:42237341-42237363 TCTCTTTCCCCTCCCTCCCGCGG - Intronic
1026892787 7:73992184-73992206 GGCCTCTCACCAGCCTCCAGCGG - Intergenic
1028743334 7:94301087-94301109 GCACTTTCCCCTCCCTTCAGCGG + Intergenic
1030672239 7:112350275-112350297 GGGCCTTCCCCTACCTTCAGAGG - Intergenic
1030765502 7:113404458-113404480 ACCCCGTCCCCTCCCTCCAGAGG - Intergenic
1032086193 7:128885064-128885086 CGCCTTTCCCCTCCCGCCCCAGG + Intronic
1032660134 7:133973914-133973936 TGCCTTCCCCCTTCCACCAGGGG - Intronic
1034446913 7:151118454-151118476 GGCTTTTCCCTTCTCTCCAGTGG + Intronic
1035979243 8:4350867-4350889 ATCCTTTCCCCTCCATCCACCGG - Intronic
1036702165 8:11019968-11019990 GCCCTATCCCTTCTCTCCAGTGG - Intronic
1037507019 8:19540777-19540799 AGCCTTTCCTCTCCCTCCACCGG + Intronic
1037588871 8:20296404-20296426 GGCCCATCCTCTTCCTCCAGAGG + Intronic
1037768119 8:21784130-21784152 TCCCTGTCCCCTCCCTCCTGAGG - Intronic
1037777674 8:21846534-21846556 GGCCTTTCCCCCCCGTGCATGGG - Intergenic
1037792231 8:21955620-21955642 GCCCTTTGCCGTCCTTCCAGGGG + Intronic
1037826748 8:22164651-22164673 GGGCTTTCGGCGCCCTCCAGCGG + Intergenic
1039457106 8:37714821-37714843 TGCCTCTCCTCTCCCTCCACTGG + Intergenic
1041410234 8:57545695-57545717 GGCCTTTCCTCTCCCATCATGGG - Intergenic
1041948384 8:63472943-63472965 GGCCTATCCCACCCCTCCAGTGG + Intergenic
1044864285 8:96554895-96554917 GGCCCAGCTCCTCCCTCCAGGGG + Intronic
1045326834 8:101123413-101123435 AACCATTCCCCTGCCTCCAGGGG + Intergenic
1046027538 8:108743825-108743847 AGCCTCTCACCTCCCTCCAGGGG + Intronic
1049404765 8:142447451-142447473 GGCCTTTCCTCTCCCAGCATGGG - Intergenic
1049531839 8:143159061-143159083 GGCCTCTGCTCCCCCTCCAGGGG - Intronic
1050626272 9:7507272-7507294 TGCCTATACCCTCACTCCAGAGG + Intergenic
1052202831 9:25803330-25803352 GGCTTTTCCCCTATCTGCAGAGG + Intergenic
1053589153 9:39493194-39493216 AACCCTTCCCCTCCCTGCAGGGG - Intergenic
1054159753 9:61665523-61665545 AGACTTTCCCCTCACCCCAGTGG - Intergenic
1054577145 9:66872101-66872123 AACCCTTCCCCTCCCTGCAGGGG + Intronic
1055433304 9:76267063-76267085 GGCATTTCACAGCCCTCCAGGGG - Intronic
1056665046 9:88574892-88574914 GGCCTGTCCCCACCATCCTGGGG + Intronic
1056746272 9:89306514-89306536 GGCCCTTGCCCTCCCTCCATGGG + Intergenic
1057230515 9:93318822-93318844 GGGCCTTCCCCTCCCACCAAGGG - Intronic
1057699679 9:97354772-97354794 GGGCTTGGCCCTCCCTTCAGAGG - Intronic
1057704334 9:97386845-97386867 CGCCTACCCCCACCCTCCAGTGG + Intergenic
1057745565 9:97748317-97748339 AGCCTTTCCACTCCCTACATTGG + Intergenic
1057819343 9:98319061-98319083 GCCCTTTCCCCTCCCTGCCTAGG - Intronic
1058726947 9:107813486-107813508 GGCCCTTCTCCTCGCCCCAGAGG + Intergenic
1060666027 9:125432738-125432760 GGCCTATGCCCTCCCTCTAAGGG - Intergenic
1060673324 9:125489973-125489995 CTCCTTTCCCTTCCCTCAAGTGG + Intronic
1060737214 9:126073649-126073671 GCCCATTCCCCACCCACCAGAGG - Intergenic
1060822920 9:126671856-126671878 CTCCACTCCCCTCCCTCCAGAGG + Intronic
1060892322 9:127196751-127196773 GGCCCCTCACCTCCCTGCAGAGG + Intronic
1061929835 9:133826802-133826824 TGCCTCTGCCCTCCCTCCCGTGG - Intronic
1062026152 9:134341706-134341728 GGCCTCTTCCCGCCCTCCATGGG + Intronic
1062277815 9:135739027-135739049 GGCCTTGCCCCTCCCAGCTGGGG + Intronic
1062491017 9:136804947-136804969 GTCCCTGCCTCTCCCTCCAGAGG + Intronic
1062580970 9:137229092-137229114 GGCCATTCCCACCCCTGCAGGGG + Exonic
1187987208 X:24827334-24827356 GGCCTTTCCTCTCTCTTCTGTGG + Intronic
1192717712 X:73661370-73661392 GGCATGTCCCCTCCTTCAAGAGG - Intronic
1193545210 X:82818394-82818416 GGCCTTGCCCCTGCCCCCTGGGG + Intergenic
1195415704 X:104618049-104618071 TTCCTTTCCCTTCCCTGCAGGGG + Intronic
1196278962 X:113800337-113800359 GGCGTTTTCCCTCCCTGCTGAGG - Intergenic
1198199976 X:134406586-134406608 GGGCATTCCCCTCCCTATAGAGG + Intronic
1199491396 X:148404200-148404222 GACCTTTCCCCTCTCACCAAGGG - Intergenic
1200060142 X:153480448-153480470 CGCCTTTCCCTTACCTCCTGAGG - Intronic
1200231862 X:154447935-154447957 GGGCTCTTCCCTCCCTCCACAGG + Intronic
1202371980 Y:24205161-24205183 GGCCTTTCCCCTTCCCTCACTGG + Intergenic
1202498805 Y:25464955-25464977 GGCCTTTCCCCTTCCCTCACTGG - Intergenic