ID: 1160796869

View in Genome Browser
Species Human (GRCh38)
Location 19:949617-949639
Sequence TCCCTCCAGTGGATGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160796863_1160796869 -9 Left 1160796863 19:949603-949625 CCTGGCCTTTCCCCTCCCTCCAG 0: 1
1: 0
2: 12
3: 105
4: 937
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796856_1160796869 26 Left 1160796856 19:949568-949590 CCAAAGTGCTGGGATTATAGGCA 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796859_1160796869 -1 Left 1160796859 19:949595-949617 CCGCCGCCCCTGGCCTTTCCCCT 0: 1
1: 0
2: 16
3: 243
4: 2174
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796855_1160796869 27 Left 1160796855 19:949567-949589 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796853_1160796869 30 Left 1160796853 19:949564-949586 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796861_1160796869 -7 Left 1160796861 19:949601-949623 CCCCTGGCCTTTCCCCTCCCTCC 0: 1
1: 0
2: 16
3: 237
4: 1583
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796860_1160796869 -4 Left 1160796860 19:949598-949620 CCGCCCCTGGCCTTTCCCCTCCC 0: 1
1: 1
2: 24
3: 358
4: 2404
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160
1160796862_1160796869 -8 Left 1160796862 19:949602-949624 CCCTGGCCTTTCCCCTCCCTCCA 0: 1
1: 1
2: 4
3: 98
4: 962
Right 1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160796869 Original CRISPR TCCCTCCAGTGGATGCCTGC TGG Intronic
900105490 1:979189-979211 TCCGGCCACTGGACGCCTGCCGG + Exonic
900405473 1:2491041-2491063 TCCTGCCTGTGGCTGCCTGCAGG + Intronic
900562334 1:3313485-3313507 TCTCTCCCCTGGATGCCTGTGGG - Intronic
901215607 1:7553461-7553483 TCCCTCCAGGGGAGCCCTGTGGG - Intronic
902617320 1:17630895-17630917 TCTCTCCTGGGGATGCCTGGGGG + Intronic
904586887 1:31585615-31585637 TCCCTCCAGGTGCTGCCTGTGGG - Intronic
904993025 1:34609026-34609048 TCCATCCAGAGGAAGCCTTCTGG + Intergenic
906851176 1:49251633-49251655 TCACTGTAGTGAATGCCTGCAGG + Intronic
907786736 1:57620088-57620110 TCCCTCCAGAGCAGGCTTGCGGG + Intronic
909382320 1:75012927-75012949 TACCTCCAGTGCTTGCCAGCAGG + Intergenic
916323615 1:163533271-163533293 TCCCTCCCGTGGAATCCTGCAGG - Intergenic
916451151 1:164921653-164921675 TGGCTCCTGTGGAGGCCTGCAGG - Intergenic
917188332 1:172387320-172387342 CCCCTCCAGTGGATGACTCCTGG + Exonic
918929191 1:190832325-190832347 TTGCTCCAGTTGATGCCTGATGG + Intergenic
919083303 1:192891651-192891673 TCCCTCCTGTGGGTGCCTGCTGG - Intergenic
920116990 1:203628405-203628427 TCCCTCCTGGGCATTCCTGCCGG + Intronic
920960214 1:210656881-210656903 CCCCTCCAGGGGCTGGCTGCTGG + Intronic
921537920 1:216374994-216375016 TCCCCTCAGTGGATGGCTGTAGG + Intronic
924010480 1:239659798-239659820 TACCTACAGTGGATACCTGAGGG + Intronic
1064007318 10:11709060-11709082 ACCTTCCAGTGGATTCCAGCAGG + Intergenic
1065960207 10:30727852-30727874 TTCCTCCAAGGGATGACTGCTGG - Intergenic
1067750068 10:48965645-48965667 TCCCTCCAGCGTACGCCTGGTGG + Intronic
1069640375 10:69951191-69951213 TTCCTGCAGTGGAAGGCTGCAGG - Intronic
1074002504 10:109387201-109387223 TTCCCCCAGAGGATGCCTGTGGG - Intergenic
1075312173 10:121423577-121423599 GCCCTCCAGAGGCTGACTGCTGG - Intergenic
1075643817 10:124084619-124084641 TTCCTCCACTGGATTCCTGGGGG - Intronic
1075904013 10:126064988-126065010 TCCTTCCAGCTGAAGCCTGCAGG - Exonic
1076450652 10:130554813-130554835 TCCCTCCAGGGGATGCAGGCTGG + Intergenic
1076480238 10:130780050-130780072 TCCCACCAGTGGATGCCTTGGGG - Intergenic
1076679686 10:132165324-132165346 TCTCTCCCGGGGTTGCCTGCAGG + Intronic
1083310952 11:61783579-61783601 GTGCTCCAGGGGATGCCTGCAGG + Exonic
1083868042 11:65469051-65469073 TCCCACCACTGGAAGCCTCCTGG + Intergenic
1085948194 11:81297782-81297804 TCCCACCACTGCATGCCAGCCGG - Intergenic
1090447449 11:126776188-126776210 TCCCTCCTGTGGCTGCTTTCAGG + Intronic
1092777349 12:11955561-11955583 TCAGGCCAGTGGCTGCCTGCTGG - Intergenic
1097733017 12:63150975-63150997 TCCCTCCAGTGGGCGTCTCCCGG + Intergenic
1099095476 12:78370143-78370165 TCCCTCCAGTGTAGGCTAGCTGG - Intergenic
1102863870 12:116359188-116359210 TTCCTCCATTGGCTGACTGCCGG + Intergenic
1104025387 12:125022181-125022203 GCCCTCCAGGGGATTCCTGGAGG + Intronic
1104982336 12:132579059-132579081 TCCCTCCTCTGGATACCTGGTGG + Intronic
1106702691 13:32246751-32246773 TCCCTCCACGGCATTCCTGCTGG - Intronic
1108713024 13:53052968-53052990 AGCCTGCAGTGGCTGCCTGCAGG + Intergenic
1109572400 13:64210288-64210310 TTCCTCCAGTGGTAGCTTGCGGG + Intergenic
1113952328 13:114078968-114078990 GCCCTCCCCAGGATGCCTGCAGG - Intronic
1119380414 14:74224671-74224693 TCCCTCCCGTCGAGCCCTGCTGG - Intergenic
1122122394 14:99561477-99561499 TCCCTCCAGGGGACACCTACAGG + Intronic
1122196837 14:100094277-100094299 CCCCTTCAGTGGTTGTCTGCTGG + Intronic
1122325337 14:100878271-100878293 TCCCTCCACTGGCTGGCTGCAGG - Intergenic
1122629443 14:103100564-103100586 CTGCCCCAGTGGATGCCTGCTGG - Exonic
1122893783 14:104745220-104745242 TGCCTCCCGTGGCTCCCTGCAGG - Intronic
1124363186 15:29053836-29053858 TCCCCACAGTGGCTGCCTCCGGG + Exonic
1124442033 15:29692710-29692732 TTCCTCTAGTGGTTGCCTGTGGG - Intergenic
1124828023 15:33119023-33119045 GTCCTCCAGTTGATACCTGCAGG - Intronic
1125533989 15:40432490-40432512 TCCCCCCAGAGGGTGTCTGCTGG + Intronic
1129061584 15:72864561-72864583 TTTCTCCAGTGGATCCCTGGAGG - Intergenic
1129340425 15:74882294-74882316 TCCCTCCAGGGGCTGAGTGCAGG - Intergenic
1130693216 15:86104394-86104416 TCACCCCAGTTGATGGCTGCAGG + Intergenic
1133105828 16:3508891-3508913 TCCCTCCCTTGGATCTCTGCTGG - Intronic
1133333225 16:4989135-4989157 TCCCATCAGTGAATGCCTGCAGG - Intronic
1135125631 16:19807102-19807124 TCCCTCTGGAGGATGCCAGCTGG + Intronic
1137774403 16:51043307-51043329 TCTCCCCAGTGGATGCCAACTGG - Intergenic
1139514997 16:67447545-67447567 TCCCTCCAGGGGAAGACAGCTGG + Intronic
1140570945 16:76105164-76105186 TCCCTACAGGGGATGAATGCTGG + Intergenic
1141777168 16:86132037-86132059 TCCCTGCAGGGGATGCCAACAGG + Intergenic
1142611355 17:1110420-1110442 TCACTCCAGCCGATGGCTGCTGG + Intronic
1144613998 17:16751887-16751909 TCCCTCCAGTGTCTGCCCCCAGG + Intronic
1144791453 17:17861724-17861746 TCCCTGCAGTGGATGCTAGGAGG + Intronic
1144898714 17:18563784-18563806 TCCCTCCAGTGTCTGCCCCCAGG - Intergenic
1145133661 17:20381939-20381961 TCCCTCCAGTGTCTGCCCCCAGG + Intergenic
1147479099 17:40742000-40742022 GCTCTCCATTGGAAGCCTGCTGG + Intergenic
1148321108 17:46753670-46753692 TCCCTTCCTTTGATGCCTGCAGG + Intronic
1149919028 17:60638920-60638942 GCCCTCTAGTGGCTGCCTGCTGG + Intronic
1150165298 17:62935672-62935694 TCTCTCCAGTGAATGCCTGTTGG - Intergenic
1151288080 17:73128003-73128025 TCCCTCCAGTGGATCCCCTAGGG - Intergenic
1153243801 18:3054252-3054274 ACCCTCCAGTGGATTCCCACTGG + Intergenic
1156366910 18:36438026-36438048 CTCCTCCAGAGGCTGCCTGCAGG + Intronic
1160476229 18:79190996-79191018 TTCCTCTGGTGGATGTCTGCTGG + Intronic
1160579811 18:79877314-79877336 TCCCTCCAGCGGCTGGCTCCCGG + Intronic
1160796869 19:949617-949639 TCCCTCCAGTGGATGCCTGCTGG + Intronic
1162306317 19:9876377-9876399 TCCCTCCAGCCGCTGCCTGGGGG - Intronic
1162930919 19:13957280-13957302 TCCCTCCTGTTGCTGCCAGCCGG - Intronic
1164577455 19:29413893-29413915 GGCCCCCAGTGGATGCCTCCAGG + Intergenic
1164917027 19:32060059-32060081 ACTCTCCAGTGGATGCCGTCTGG - Intergenic
1165065762 19:33226957-33226979 TCCCCCCAGTGGCGGCCTCCGGG + Intergenic
1165092401 19:33394011-33394033 TCCGTCCAGGGGACGGCTGCAGG - Intronic
1165102754 19:33448467-33448489 TCACTCCTGTGGGTGCCTCCAGG - Intronic
1166228458 19:41411690-41411712 TCCCGGCAGTTGCTGCCTGCGGG + Intronic
927577071 2:24208812-24208834 TCCCTGCAGGGGCTGCCCGCAGG - Intronic
927774028 2:25888186-25888208 TCCCTTCAGGGGATCCCTTCAGG - Intergenic
930541570 2:52713138-52713160 TCCCTGCAGTGGGAACCTGCTGG - Intergenic
934226763 2:90139544-90139566 TCACTTCACTGGATGACTGCAGG - Intergenic
934232787 2:90200828-90200850 TCACTTCCCTGGATGCCTGCAGG - Intergenic
936074667 2:109394264-109394286 GACCTCGAGTGGCTGCCTGCTGG - Intronic
936081694 2:109436882-109436904 TCTCTCCACAGGGTGCCTGCAGG + Exonic
947393270 2:229661953-229661975 TCCTTCTTGTGGCTGCCTGCTGG - Intronic
947856848 2:233329934-233329956 CCCCTGCTGTGGATGCCAGCTGG - Intronic
948009408 2:234638693-234638715 TCCCTCTAGAGGATTCCTGCTGG - Intergenic
948474903 2:238211135-238211157 TTCCTCCTGTGGATGGCTGGGGG + Intergenic
1170803835 20:19612726-19612748 TCCCTCCTTGGGATGACTGCAGG + Intronic
1172064283 20:32207999-32208021 CCGCTCCCGGGGATGCCTGCGGG + Exonic
1173664094 20:44753033-44753055 TTGCTCCAGTGCATGTCTGCTGG - Intronic
1175353866 20:58346479-58346501 TCCCTCCACTGGAGCCCAGCTGG + Intronic
1175747094 20:61464780-61464802 ACCCCCCAGTGGATGCTGGCAGG - Intronic
1175941548 20:62539678-62539700 TCCCTCCAGAAGAGGCCTGGTGG - Intergenic
1179300128 21:40101030-40101052 TCCCTCAAGTCCATGCCTGGCGG - Intronic
1179878766 21:44284884-44284906 CCCCTCCAGGCCATGCCTGCGGG + Intergenic
1183213815 22:36466638-36466660 TCCTTCCCATGGGTGCCTGCAGG - Intergenic
952239377 3:31514391-31514413 TGTGTCCAGTGGATGCCGGCAGG + Intergenic
952898246 3:38093470-38093492 TCCCTCCAGTGTGAGCTTGCAGG + Intronic
953380634 3:42469594-42469616 TGGCTCCTGTGGAGGCCTGCTGG + Intergenic
954456401 3:50601962-50601984 TCCTTCCAGTGGATGGCTGTGGG - Intergenic
954660349 3:52223746-52223768 CACCTCCAGTGCCTGCCTGCAGG + Exonic
956699577 3:71947409-71947431 GCCCTCCACTGGAGGGCTGCAGG - Intergenic
960828954 3:121824181-121824203 GACCCCCAGTGGATGCCTGAAGG + Intronic
961775626 3:129282474-129282496 CCACTCCAGTGGATGCATCCTGG + Intronic
962306807 3:134294704-134294726 TCCATCCAGCAGATGTCTGCTGG - Intergenic
962344762 3:134610939-134610961 TTCCTCCCAAGGATGCCTGCAGG + Intronic
962374865 3:134851153-134851175 TCCCTCCAGACAAGGCCTGCTGG - Intronic
964317825 3:155462861-155462883 GCTCCCCAGTGGATGCCTGGAGG + Intronic
968713210 4:2135892-2135914 TCCCAGTAGAGGATGCCTGCAGG - Intronic
970483992 4:16506103-16506125 ACCAGACAGTGGATGCCTGCAGG + Intronic
972822022 4:42712949-42712971 GCCCTCCAGAGGATGCTTGTAGG - Intergenic
973536235 4:51885191-51885213 TCCCTTCAGTGGCTGTTTGCAGG + Intronic
976711646 4:88078333-88078355 GCACTTCAGTGTATGCCTGCTGG - Intergenic
980560471 4:134466292-134466314 TCCTTCTAGTGTATGTCTGCTGG - Intergenic
980944928 4:139310038-139310060 TCCCTTCAGTTGAGGCCAGCTGG - Intronic
982971679 4:161996245-161996267 TGACTCCAGTGGGTGGCTGCAGG + Intronic
985606980 5:863051-863073 CCGTTCCAGTGGCTGCCTGCAGG - Intronic
986841851 5:11706599-11706621 TCCTATCAGTGGATGCCTGCGGG - Intronic
986842066 5:11708845-11708867 TCCCATCAGTGGATGCCTGTGGG - Intronic
997311283 5:132885630-132885652 ACCCTTCAGTAGTTGCCTGCTGG - Intronic
999283367 5:150379523-150379545 TCCCTCCAGGTGAAGCCTTCAGG + Exonic
999421394 5:151447729-151447751 TTCCTCCACTGGCTGCCGGCTGG + Exonic
999613005 5:153391130-153391152 TCCCTCCACTGGCTGCCAGGTGG + Intergenic
1002898998 6:1395075-1395097 TCCCTCATGTGGGAGCCTGCAGG - Exonic
1003305951 6:4929109-4929131 TCCTTACAGTGCAGGCCTGCTGG + Intronic
1006681239 6:35798099-35798121 TCACACCAGGGGCTGCCTGCAGG + Intergenic
1007589420 6:43012475-43012497 TCCAGGCAGGGGATGCCTGCCGG + Exonic
1011703746 6:89980705-89980727 ACCTTCCAGTGGAGGCCAGCAGG - Intronic
1017026976 6:150189940-150189962 ACCCTCCTGTAGATGCCTGGAGG - Intronic
1019221091 6:170473381-170473403 TGCCTCTGGTGGAAGCCTGCAGG - Intergenic
1020132954 7:5569894-5569916 CCCCTCCACTGGTTTCCTGCTGG - Intergenic
1021244513 7:18245253-18245275 TACCACAAGGGGATGCCTGCTGG - Intronic
1022345691 7:29512160-29512182 TCCCTCTTGTGGCTTCCTGCTGG - Intronic
1024050746 7:45621650-45621672 TCCCTCCTGTCCCTGCCTGCTGG + Intronic
1027371614 7:77512066-77512088 TACCTCCAGTGAATGTCAGCTGG + Intergenic
1034997027 7:155584074-155584096 TCCCTCTTCTGGATGACTGCAGG + Intergenic
1035374965 7:158401830-158401852 TCCCTCCACTGGGCACCTGCTGG - Intronic
1035773425 8:2168688-2168710 ACCCCCCAGTGCATGGCTGCAGG + Intergenic
1037917315 8:22780577-22780599 GCCCACCAGAGGATGCCTCCTGG + Intronic
1038839564 8:31169999-31170021 TCTTTCCAGTGTATGCCTGTGGG + Intronic
1039762502 8:40592441-40592463 ACCCTGCAGTCCATGCCTGCAGG - Intronic
1040000785 8:42574984-42575006 TCCCTCCAATATATGCCTGGGGG - Intergenic
1041005702 8:53495294-53495316 TCCCCACAGTGGAGGCCTCCAGG - Intergenic
1043487641 8:80713881-80713903 TCCCTGTAGTGCATGCCTGAGGG - Intronic
1045414362 8:101951839-101951861 TCCTACCTGTGGATGCCTGAGGG - Intronic
1047402117 8:124556442-124556464 TGCCTCCACTGGAGGGCTGCGGG + Intronic
1048017321 8:130509101-130509123 TCCCTCCAGTCTCTGCCTCCAGG + Intergenic
1049694893 8:143978297-143978319 CCCCTCCCGTGGAGGTCTGCGGG + Intronic
1050885077 9:10754001-10754023 TCACAGCAGTGGATGCCTGAGGG - Intergenic
1054782281 9:69176153-69176175 TCCCTTCAGGGGATTCTTGCTGG + Intronic
1055013198 9:71589555-71589577 TGGCTCCTGTGGAGGCCTGCTGG + Intergenic
1055076295 9:72218594-72218616 TCCCACCAGTTTATGCCTGCAGG - Intronic
1056572202 9:87825620-87825642 TGTCTCCAGTGGGTTCCTGCTGG + Intergenic
1057172972 9:92975005-92975027 ACCCTACAGTGCATGGCTGCTGG + Intronic
1062047585 9:134431647-134431669 TCCCTCTAGGGTCTGCCTGCGGG - Intronic
1062414058 9:136439174-136439196 TCGCTCCAGTCGAGGCCTGGCGG + Exonic
1187093698 X:16124231-16124253 GTGCTCCAGTGGATGCCAGCAGG + Exonic
1187388898 X:18873043-18873065 TCCCTCCTGCGGATGCCCCCAGG - Intergenic
1189105801 X:38233968-38233990 TACCTCCAGCAGATGCTTGCTGG - Intronic
1189741241 X:44119081-44119103 TGGCTCCACTGGTTGCCTGCTGG - Intergenic
1190064100 X:47228785-47228807 TCCCTCCAGCCGCTGCCTGCTGG - Exonic
1190506815 X:51134687-51134709 TCCCACCAGTGCATTCCTGATGG - Intergenic
1197798926 X:130328746-130328768 TCACTCCATTGGAGGCCTCCTGG + Intergenic
1198214492 X:134544720-134544742 TTCCTCCAGTGGACGCCTGCAGG - Intergenic
1200216174 X:154369153-154369175 GCCCTCCAGGTGCTGCCTGCTGG - Intronic
1200767718 Y:7094415-7094437 TCCTTCCTGTGGCTGCATGCAGG + Intergenic