ID: 1160797990

View in Genome Browser
Species Human (GRCh38)
Location 19:954587-954609
Sequence TGGGGCCATGCGAGGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160797980_1160797990 20 Left 1160797980 19:954544-954566 CCAGGGCAGACAGACGAGAGACA No data
Right 1160797990 19:954587-954609 TGGGGCCATGCGAGGGCTGGGGG No data
1160797979_1160797990 29 Left 1160797979 19:954535-954557 CCGCATGTTCCAGGGCAGACAGA No data
Right 1160797990 19:954587-954609 TGGGGCCATGCGAGGGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160797990 Original CRISPR TGGGGCCATGCGAGGGCTGG GGG Intronic