ID: 1160799322

View in Genome Browser
Species Human (GRCh38)
Location 19:960479-960501
Sequence GTCCCCACTACTGGGTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160799312_1160799322 7 Left 1160799312 19:960449-960471 CCTTAGCATCCAGGGTGCAGTGA 0: 1
1: 0
2: 1
3: 8
4: 274
Right 1160799322 19:960479-960501 GTCCCCACTACTGGGTAATGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
1160799317_1160799322 -2 Left 1160799317 19:960458-960480 CCAGGGTGCAGTGAAGTGGGGGT 0: 1
1: 0
2: 2
3: 53
4: 1174
Right 1160799322 19:960479-960501 GTCCCCACTACTGGGTAATGGGG 0: 1
1: 0
2: 1
3: 7
4: 129
1160799309_1160799322 18 Left 1160799309 19:960438-960460 CCAGGTCATCTCCTTAGCATCCA 0: 1
1: 0
2: 1
3: 17
4: 155
Right 1160799322 19:960479-960501 GTCCCCACTACTGGGTAATGGGG 0: 1
1: 0
2: 1
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160799322 Original CRISPR GTCCCCACTACTGGGTAATG GGG Intronic
900582541 1:3416195-3416217 GTCCCCACCACTGGCTCATGTGG + Intronic
908711393 1:67019586-67019608 TCCCTCACTACTGAGTAATGGGG + Intronic
915255690 1:154627190-154627212 GGCCCCACTAGAGGGTAATCCGG - Intronic
920725045 1:208427181-208427203 ATCCCCAGTACTGCGGAATGTGG + Intergenic
920993553 1:210964104-210964126 GTCCCCACTTCTGGCTTGTGGGG - Intronic
922482825 1:225950944-225950966 CTCCCCACTTCTGGGTATGGAGG - Intergenic
922964408 1:229676011-229676033 GTCCCCAAAACTGGGAAATAAGG - Intergenic
1062856038 10:779913-779935 GTCTACACTGCAGGGTAATGAGG + Intergenic
1062856065 10:780051-780073 GTCTACACTGCAGGGTAATGAGG + Intergenic
1062856138 10:780365-780387 GTCTACACTGCAGGGTAATGAGG + Intergenic
1062856164 10:780503-780525 GTCTACACTGCAGGGTAATGAGG + Intergenic
1069823278 10:71240369-71240391 GTCCCCCCTACTGGGAGAAGGGG - Intronic
1075407210 10:122203214-122203236 GCCGCCCCTACTGGGAAATGAGG - Intronic
1078177224 11:8978963-8978985 GCCGCCCCTACTGGGAAATGAGG + Intergenic
1079795529 11:24798313-24798335 GTCCCAACTACTTGGGAATGAGG - Intronic
1080504519 11:32899315-32899337 GTCCCAACTACAGGGTAGAGGGG - Intronic
1081681067 11:45003288-45003310 GTGCACACTTCTGGGTAATTGGG + Intergenic
1083170718 11:60922667-60922689 CTCCCTACTGCTGGGCAATGAGG - Exonic
1100529354 12:95449651-95449673 CTCCTCACTACTGAGAAATGAGG - Intergenic
1101396294 12:104351372-104351394 GTCACCACCACTAGATAATGAGG + Intergenic
1102990257 12:117310390-117310412 GTCCCCATTAGTGGGTAAAGAGG - Intronic
1104402226 12:128485570-128485592 GTTGCCACTACTGGGGAGTGGGG + Intronic
1105310764 13:19207988-19208010 GTCCCCGCTACTTGGTAAGATGG + Intergenic
1114165397 14:20213211-20213233 GCCACCACTACTGGGAAGTGAGG + Intergenic
1117277453 14:54204342-54204364 GTCGCCCCTACTGGGAAGTGAGG + Intergenic
1117411625 14:55456250-55456272 GTCGCCCCTACTGGGAAGTGAGG - Intronic
1120309747 14:82814174-82814196 GCCGCCCCTACTGGGAAATGAGG - Intergenic
1120574038 14:86158376-86158398 GACCACACTACTTGGTAATATGG - Intergenic
1122072934 14:99216507-99216529 GTCCACAGTGCTGGGAAATGTGG - Intronic
1127678459 15:61269108-61269130 GTCCCCAGTATTCAGTAATGAGG + Intergenic
1127706895 15:61556345-61556367 GACCTCACTAGTCGGTAATGGGG + Intergenic
1128338645 15:66804517-66804539 CTTCCCACTACAGGATAATGGGG + Intergenic
1130008487 15:80126984-80127006 GTCCCAGCTACTGGGTAGGGAGG + Intronic
1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG + Intergenic
1136425877 16:30169212-30169234 GTCACCCCTACTGGGAAGTGAGG + Intergenic
1139703759 16:68726207-68726229 GTCACCTCTTCTGGGAAATGGGG + Intergenic
1141684885 16:85564574-85564596 GTCCCCACTGGTGAGGAATGTGG - Intergenic
1144674669 17:17154141-17154163 GTGCCCACTACTGGGACATGAGG - Intronic
1152505409 17:80746438-80746460 GTTCCCACGTGTGGGTAATGTGG - Intronic
1153198925 18:2629965-2629987 GTCCCTACTGCTGGGGAATATGG - Intergenic
1153292854 18:3518881-3518903 GTCCACACTACTGGGGAGGGAGG - Intronic
1153824604 18:8864055-8864077 GTCACCATTGCTGGGTCATGTGG - Intergenic
1154055982 18:11014329-11014351 GTGCCCACCACTGAGGAATGAGG - Intronic
1154464797 18:14632887-14632909 GTCCCCAATACAGGGTGATCTGG + Intergenic
1157306189 18:46519328-46519350 GTCCAGGCTTCTGGGTAATGGGG - Intronic
1160799322 19:960479-960501 GTCCCCACTACTGGGTAATGGGG + Intronic
1160857722 19:1224816-1224838 GTACCCAGTACTGAGTACTGAGG - Intronic
1161476414 19:4488382-4488404 GTGACCACTTCTGGGCAATGGGG - Intronic
1161817840 19:6510750-6510772 GTCCTCACTGCTAGGCAATGGGG - Intergenic
1164243313 19:23409130-23409152 GTCCCAGCTACTGGGAAGTGGGG + Intergenic
1164325939 19:24191837-24191859 AACCCCACAACTGGGTAAGGAGG + Intergenic
1165068155 19:33240873-33240895 GTGCCTACAACTGGGAAATGGGG + Intergenic
1167435017 19:49474329-49474351 GTCCCCACTCCTGGGGCAGGGGG + Intronic
1168695928 19:58404788-58404810 GCCGCCCCTACTGGGAAATGAGG - Intronic
928676182 2:33654166-33654188 CTGCCCACTTCTGGGTAGTGGGG + Intergenic
930079064 2:47432969-47432991 GCCGCCCCTACTGGGTAGTGAGG - Intronic
933621355 2:84546039-84546061 GTGACCACTAATGGGTAATGAGG - Intronic
938190475 2:129275096-129275118 GCCCCCACTGCTGTGCAATGCGG + Intergenic
938887431 2:135666241-135666263 GTCAGCACTACTGGGTAAGCAGG + Intronic
939561794 2:143741090-143741112 GGGACCACTACTGGGCAATGCGG - Intronic
942231994 2:173868985-173869007 ATGCCCACTCCTGGGTATTGAGG + Intergenic
942817724 2:180071692-180071714 TTCCCAATTACTGGGTGATGGGG - Intergenic
944233140 2:197415930-197415952 GTCCCAGCTACTGGGGTATGGGG - Intronic
944435264 2:199682071-199682093 GGCCACATTTCTGGGTAATGTGG - Intergenic
944550137 2:200838262-200838284 GTGGCCACTACTGGGGGATGGGG - Intergenic
945981561 2:216316536-216316558 GTCCACAGTCCTGGGAAATGGGG + Intronic
1170120578 20:12907264-12907286 ATTCCCACTACTGGTTAATGGGG - Intergenic
1171433757 20:25103955-25103977 GGCCCCACCACTGGGGAAGGAGG - Intergenic
1171433770 20:25103990-25104012 GGCCCCACCACTGGGGAAGGAGG - Intergenic
1171433782 20:25104025-25104047 GGCCCCACCACTGGGGAAGGAGG - Intergenic
1171887380 20:30667439-30667461 AACCCCACTACTGGGTATTCAGG + Intergenic
1171951956 20:31427860-31427882 GCCGCCCCTACTGGGAAATGAGG + Intergenic
1172279454 20:33699622-33699644 GCCGCCCCTACTGGGAAATGAGG + Intergenic
1172279528 20:33699797-33699819 GCCGCCCCTACTGGGAAATGAGG + Intergenic
1172279602 20:33699972-33699994 GCCGCCCCTACTGGGAAATGAGG + Intergenic
1176809740 21:13525496-13525518 GTCCCCAGTACAGGGTGATCTGG - Intergenic
1178290239 21:31361483-31361505 GTACAGCCTACTGGGTAATGTGG - Intronic
1178551206 21:33541540-33541562 GTCCTCACCACTGGGTAGTAAGG - Intronic
1179896609 21:44366798-44366820 GCCCCCAGTGCTGGGTCATGAGG - Exonic
1181132323 22:20739375-20739397 GTCCCAGCTACTGGGTCAGGAGG + Intronic
1181346482 22:22223392-22223414 GTCCCCACTCCCGGGCGATGAGG - Intergenic
1182134085 22:27884206-27884228 GTCCCCCCCAGGGGGTAATGGGG - Intronic
1182383096 22:29910037-29910059 GTCCCCACTACTCGCTACTCGGG + Intronic
1183399785 22:37595824-37595846 GACCCCACTAATGGGTAAGTTGG + Intergenic
1184621014 22:45676893-45676915 GTCCCAGCTACTGGGGAAGGAGG - Intronic
1184829050 22:46972367-46972389 GTCTCCACCAAGGGGTAATGTGG - Intronic
1185014611 22:48335641-48335663 GTCCCCACTGTGGGGTGATGCGG + Intergenic
949173085 3:1026239-1026261 GATCCCACAACTGGCTAATGAGG - Intergenic
950498439 3:13348479-13348501 CTCCCCTCTTCTTGGTAATGGGG + Intronic
951676824 3:25250536-25250558 GTCCCCACTACTGGGGATTGTGG + Intronic
956270832 3:67445058-67445080 GCCCCCCCTACTGGGAAGTGAGG + Intronic
961788386 3:129360909-129360931 GTCCCCACTGCATAGTAATGGGG + Intergenic
963556317 3:146793013-146793035 GTCCCAACTACTGGGGGCTGAGG - Intergenic
967965360 3:194956374-194956396 GTCCCTACTACCGGGTGATGCGG + Intergenic
970098087 4:12487503-12487525 GTGGCCACTACCGGGGAATGAGG + Intergenic
976122552 4:81799390-81799412 GTCCCCACTGCTAGGTGATCTGG - Intronic
976340754 4:83943560-83943582 GCCGCCCCTACTGGGAAATGAGG - Intergenic
978409296 4:108410009-108410031 GCCGCCCCTACTGGGAAATGAGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980126503 4:128779559-128779581 GCCCCCTCTCCTGGGTAATATGG + Intergenic
986667765 5:10118076-10118098 GTGCCCACTTTTGGGTTATGGGG - Intergenic
996070009 5:119122365-119122387 GTCGCCCCTACTGGGAAGTGAGG - Intronic
996845283 5:127891972-127891994 GGCAGCAGTACTGGGTAATGTGG - Intergenic
1005752427 6:28895939-28895961 GTCCCAGCTACTCGGGAATGAGG - Intergenic
1006004708 6:30993123-30993145 GCCGCCACTACTGGGAAGTGAGG - Intergenic
1006209660 6:32384740-32384762 GTCGCCCCTACTGGGAAGTGAGG - Intergenic
1006492717 6:34398566-34398588 GCCGCCCCTACTGGGAAATGAGG + Intronic
1007021728 6:38528054-38528076 ATGGCCACTACTGGGGAATGGGG - Intronic
1007729745 6:43938736-43938758 GTCCCCTGTTCTGGGTCATGAGG - Intergenic
1011405326 6:87010417-87010439 GTCGCCCCTACTGGGAAGTGAGG - Intronic
1015497096 6:133893313-133893335 GTCGCCACCCCTTGGTAATGAGG - Exonic
1016802071 6:148178701-148178723 GCCGCCCCTACTGGGAAATGAGG - Intergenic
1017119185 6:151007619-151007641 GGCCCCAGTACTGGATTATGCGG - Intronic
1017480890 6:154853467-154853489 GTCCCAGCTACTTGGTACTGAGG - Intronic
1023050591 7:36247802-36247824 GCTCCCACTCCTGGGAAATGCGG - Intronic
1025831812 7:65058576-65058598 TTCCCTACTAATGGGTAATTAGG - Intergenic
1034234284 7:149555033-149555055 GCCGCCCCTACTGGGAAATGAGG + Intergenic
1035263618 7:157676589-157676611 GTCCCCACTGCAGGGTGTTGAGG - Intronic
1038328897 8:26592268-26592290 GTCCCAACTACTGGGACAAGAGG - Intronic
1038997888 8:32945756-32945778 ATCCCCACTGCTGGGGAAGGTGG + Intergenic
1041159019 8:55018402-55018424 ATCCCCACTGGAGGGTAATGAGG + Intergenic
1041251117 8:55935654-55935676 GTCCCCACTACTTGCTACTCAGG + Intronic
1042293710 8:67197334-67197356 GTCCTCACTACTGGGGAGGGTGG + Intronic
1043854885 8:85253758-85253780 GACCCCGCTACTGGGGAAGGAGG + Intronic
1048389468 8:133947855-133947877 GTCCCTCCTACTGGCTCATGAGG - Intergenic
1052876007 9:33564549-33564571 AACCCCACTACTGGGTATTCAGG - Intronic
1053500004 9:38579812-38579834 AACCCCACTACTGGGTATTCAGG + Intergenic
1203692277 Un_GL000214v1:55482-55504 AACCCCACTACTGGGTATTCAGG + Intergenic
1203556463 Un_KI270744v1:2374-2396 AACCCCACTACTGGGTATTCAGG + Intergenic
1203644018 Un_KI270751v1:48709-48731 AACCCCACTACTGGGTATTCAGG - Intergenic
1192813319 X:74568462-74568484 GCCGCCACTACTGGGAAGTGAGG - Intergenic
1193886768 X:86992647-86992669 TTCCCCACTACTGGGGAACCAGG + Intergenic
1195035951 X:100972284-100972306 GCCCCCCCTACTGGGAAGTGAGG - Intronic
1197394221 X:125906865-125906887 GTGCACACCACTGGGGAATGAGG - Intergenic
1198759536 X:140017244-140017266 ATACCCACCCCTGGGTAATGAGG - Intergenic
1198779254 X:140216806-140216828 ATACCCACCCCTGGGTAATGAGG + Intergenic
1199714489 X:150496720-150496742 GTCAGCAATGCTGGGTAATGAGG - Intronic
1200827756 Y:7660972-7660994 TTTCCCACTGCTGGGTAAGGTGG - Intergenic