ID: 1160802400

View in Genome Browser
Species Human (GRCh38)
Location 19:976459-976481
Sequence ACCACAAATGCCCCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160802400_1160802412 17 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802412 19:976499-976521 CGCTCCTGGTGTGGAGTGGGTGG No data
1160802400_1160802405 -7 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802405 19:976475-976497 TTGTGGTTGTCACGCCTGGGGGG No data
1160802400_1160802407 3 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802407 19:976485-976507 CACGCCTGGGGGGGCGCTCCTGG No data
1160802400_1160802406 -6 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802406 19:976476-976498 TGTGGTTGTCACGCCTGGGGGGG No data
1160802400_1160802415 26 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802415 19:976508-976530 TGTGGAGTGGGTGGAGTCCTGGG No data
1160802400_1160802410 13 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802410 19:976495-976517 GGGGCGCTCCTGGTGTGGAGTGG No data
1160802400_1160802411 14 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802411 19:976496-976518 GGGCGCTCCTGGTGTGGAGTGGG No data
1160802400_1160802404 -8 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802404 19:976474-976496 TTTGTGGTTGTCACGCCTGGGGG No data
1160802400_1160802402 -10 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802402 19:976472-976494 CATTTGTGGTTGTCACGCCTGGG No data
1160802400_1160802414 25 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802414 19:976507-976529 GTGTGGAGTGGGTGGAGTCCTGG No data
1160802400_1160802409 8 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802409 19:976490-976512 CTGGGGGGGCGCTCCTGGTGTGG No data
1160802400_1160802403 -9 Left 1160802400 19:976459-976481 CCATGTCTGGGGGCATTTGTGGT No data
Right 1160802403 19:976473-976495 ATTTGTGGTTGTCACGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160802400 Original CRISPR ACCACAAATGCCCCCAGACA TGG (reversed) Intergenic
No off target data available for this crispr