ID: 1160804236

View in Genome Browser
Species Human (GRCh38)
Location 19:984769-984791
Sequence GCTCAGGCCTGAGCTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160804229_1160804236 6 Left 1160804229 19:984740-984762 CCTGTTAGGCCGCTCTGCGCACG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1160804236 19:984769-984791 GCTCAGGCCTGAGCTGCTATGGG 0: 1
1: 0
2: 0
3: 12
4: 155
1160804233_1160804236 -3 Left 1160804233 19:984749-984771 CCGCTCTGCGCACGCGCGGGGCT 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1160804236 19:984769-984791 GCTCAGGCCTGAGCTGCTATGGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160804236 Original CRISPR GCTCAGGCCTGAGCTGCTAT GGG Intronic
900973151 1:6002458-6002480 GCTGTGGCCTGAGCTGGCATCGG + Intronic
902767506 1:18627283-18627305 GCTCTGGCCTGCTCTGCTAGAGG - Intergenic
903235655 1:21949030-21949052 TCTGAAGTCTGAGCTGCTATTGG + Intergenic
904303001 1:29568060-29568082 GCTCAGGGCAGAGCTGCTCAGGG + Intergenic
904649025 1:31990339-31990361 GATCAGGCCTGAGTTGATATTGG - Intergenic
905457297 1:38097001-38097023 GCTGAGGCCTGGGCTGATAGAGG + Intergenic
905887944 1:41501791-41501813 GCCCAGGCCTGAGCTGGCATAGG - Intergenic
908199894 1:61783627-61783649 GCTCAGGTCTGAATTCCTATAGG + Intronic
912301856 1:108526083-108526105 GCTCAGCCCTGGGCTTCTGTGGG - Intergenic
913205189 1:116532314-116532336 GCTCAGGCGAGAGCTGCCACGGG - Intronic
915637447 1:157196310-157196332 GCTGAGCCCTGAGCTATTATGGG - Intergenic
915903375 1:159861917-159861939 TCTCAGGCCTGAGCTGTCACTGG + Intronic
917136807 1:171795964-171795986 GCTGAGGCAGGAGCTGCTAGTGG - Intronic
917499810 1:175575946-175575968 GCCCAGGCCTGCTCTGCTAGGGG + Intronic
923384883 1:233455877-233455899 GGTCAGCCCTGAGCTTCTCTGGG + Intergenic
1063387519 10:5625352-5625374 GCTCAGGCCCGAGGTTCAATTGG + Intergenic
1063424626 10:5941677-5941699 CCTCATGCCTGGGCTGCTAAAGG - Intronic
1063698800 10:8364577-8364599 GCTCAGGCCTGGGCTGCTGAAGG - Intergenic
1066492734 10:35909430-35909452 GCTGAGGCCTGCACTGCTTTGGG + Intergenic
1067791839 10:49294159-49294181 GATCAGGGCTGAGCTGCTCATGG - Intergenic
1069558835 10:69415470-69415492 GCTCAGCCCTGAGCAGCGTTGGG + Intronic
1069878528 10:71577756-71577778 GCTCAGGCATCAGCTGCCCTGGG - Intronic
1070786884 10:79167051-79167073 GCTCTGGCCTGAGTTTCTATGGG + Intronic
1071509421 10:86251819-86251841 GCCCAGCCCTGAGCTGCTCAGGG - Intronic
1072435060 10:95407223-95407245 GCTGAGGCCAGAGCTGCACTGGG - Intronic
1076066337 10:127451145-127451167 GCTCAAGACTGGGCTGCTATGGG - Intronic
1077416521 11:2426628-2426650 GCTCTGCCCTGAGCTGGTCTTGG - Intergenic
1077560710 11:3258482-3258504 GCTCAGTCCTGAGCCCCCATGGG + Intergenic
1077566606 11:3304310-3304332 GCTCAGTCCTGAGCCCCCATGGG + Intergenic
1077600710 11:3572556-3572578 GCTCCTGCCTCAGCTGCTCTAGG - Intergenic
1078532576 11:12148507-12148529 GCTCTGACCTGAGCTACCATGGG - Intronic
1081082414 11:38758441-38758463 ACTCAGGGCTTAGCTGCTATGGG - Intergenic
1081621698 11:44622584-44622606 AGTCAGGCCTGAGCTGGAATGGG + Intergenic
1083052388 11:59788886-59788908 TCTCAGTCGTGAGCTGCTCTAGG - Exonic
1083998184 11:66282486-66282508 GCTCAGGGCTGAGTTCCTCTTGG + Intronic
1084939725 11:72606095-72606117 ACTGAGGCCAGAGCTGCTCTGGG - Intronic
1086520251 11:87661022-87661044 GATCAGGCCTGAGCTGGAGTGGG - Intergenic
1087050793 11:93884512-93884534 GCTCAGGCCTGTACACCTATGGG - Intergenic
1092266237 12:6982641-6982663 GCTGTAGCCTGAGCTGCTAAGGG + Intronic
1093979448 12:25459707-25459729 GCCCAGGCCTGAGGGGCAATGGG - Intronic
1097267833 12:57755876-57755898 GCCCAGGCCTGACCTGCTCCGGG - Exonic
1098176643 12:67799056-67799078 GCTCAGGCCAGAAATGCCATGGG - Intergenic
1098951613 12:76645485-76645507 GCTCAGTCCAGAGCTTTTATGGG - Intergenic
1100267496 12:92991445-92991467 GCTCAGGACTGCTCTGCTTTTGG + Intergenic
1100465079 12:94837137-94837159 GCTCAGGGCTGAGATCCTCTTGG - Intergenic
1102207185 12:111098675-111098697 GCTCTTGTCTGAGCTGCTCTGGG - Intronic
1106411445 13:29514180-29514202 GCTCGGGGCTGAGCTGGTAGGGG + Exonic
1106483024 13:30150828-30150850 GCCCAGGACTGAGGGGCTATGGG - Intergenic
1107765601 13:43730857-43730879 GCTCAGGCCTCAGCTCCTCCAGG + Intronic
1111349626 13:87010123-87010145 GCTCATGGCTTGGCTGCTATAGG + Intergenic
1111911831 13:94321773-94321795 GCTCAGGCCTGGGGAGCTCTGGG - Intronic
1111993204 13:95137324-95137346 TCACAGGCCTCAGCTGCTACAGG + Intronic
1112823054 13:103357989-103358011 GCTTAGGACTGAGCTGGTACTGG + Intergenic
1113944101 13:114033973-114033995 GCTCAGCCCTGAGCTCTGATGGG - Intronic
1115618931 14:35122011-35122033 GCTGACGCCTGAGCTGGTAGGGG - Exonic
1119407020 14:74405364-74405386 GCTCAGGTCTGAGAGGATATTGG + Intergenic
1121278883 14:92686132-92686154 GCTCAGGACTGGTCTGCTCTGGG - Intronic
1121325916 14:93019531-93019553 CATCAGGCCTGGGCTGCTCTCGG + Intronic
1122974083 14:105163950-105163972 GCTTCGGCCTGAGCTGCTGCTGG - Intronic
1123115396 14:105892110-105892132 GGTCTGGCCTGAGCCGCTGTGGG + Intergenic
1124124793 15:26929523-26929545 GCACAGGCATAAGCTGCTACAGG - Intronic
1125001400 15:34774140-34774162 GCTCAGGTTTCAGCTGCTCTGGG - Intergenic
1128240190 15:66096385-66096407 GCTCAGGCCTCAGCTTCTCCAGG - Intronic
1128529086 15:68431890-68431912 GGTCAGACCTCAGCTGCTCTTGG - Intronic
1129670677 15:77606150-77606172 GCTCTGGACTGAGCTGCGCTTGG + Intergenic
1130578909 15:85117404-85117426 GCTGAGGTCAGAGCTGCTGTGGG + Intronic
1131051266 15:89349599-89349621 TCACAGGCCTTAGCTGCCATTGG - Intergenic
1132333826 15:101030444-101030466 GCTCAGGCCTGAGCCTCTGGAGG - Intronic
1132626074 16:892284-892306 GTCCAGGCCTGAGATGCTCTAGG + Intronic
1133033779 16:3023718-3023740 GCTTAGGCGTGAGCTGAGATGGG - Intronic
1133215979 16:4292731-4292753 GCGCAGGCCAGTGCTGCTGTGGG + Intergenic
1133267120 16:4591934-4591956 GCTCTGGCCTGAGCTGGCAGAGG + Intronic
1134216338 16:12319739-12319761 GATCTGGGCTGAGCTGCTCTGGG - Intronic
1136067049 16:27766410-27766432 GCGCAGGCCTGCGATGCTTTCGG - Exonic
1136092964 16:27933856-27933878 GCCCAGCCCTGAGCAGCTACGGG - Intronic
1137018828 16:35402206-35402228 GCTCAGGGCTGAGCTTGTGTGGG + Intergenic
1137025320 16:35468345-35468367 GCTCAGGGCTGAGCTGGTGTGGG + Intergenic
1138562844 16:57812370-57812392 GGTCAGGCCAGAGCTGCCTTTGG + Intronic
1141506965 16:84484140-84484162 GTTCAGGCCTCAGCTGCGATAGG + Intronic
1142769333 17:2085365-2085387 GTTCAGGCCTGTGCTGCATTGGG + Intronic
1143314164 17:6018931-6018953 CTTCAGGCTTGAGCTGCTATGGG - Intronic
1145903300 17:28501629-28501651 GCCCAGGGCTGGGCTGCTTTGGG - Intronic
1147964784 17:44188661-44188683 GCTGAGGCCTGAGTTTCTCTAGG - Intronic
1151428896 17:74049435-74049457 GCTCAGGCCTGAGGGGCCAGGGG - Intergenic
1151892379 17:76958430-76958452 GGTCAGGCCTGGGCAGCTGTGGG - Intergenic
1152103254 17:78314884-78314906 GCCCAGGGCTGAGCTGTTTTCGG + Intergenic
1152290519 17:79437418-79437440 GCTCAGCTCAGAGGTGCTATGGG - Intronic
1152666019 17:81570141-81570163 GCTCAGGCCAGAGATGCTGCTGG - Intronic
1155311510 18:24528953-24528975 GGTCAAGGCTGTGCTGCTATTGG - Intergenic
1155651590 18:28150209-28150231 GCTCCGGCCTGACCTGTCATGGG - Intronic
1156630954 18:38967848-38967870 TCCAAGGCCTGAGCTGTTATTGG - Intergenic
1157553036 18:48594487-48594509 GCTGAGGCCTGAGCTGTTTGTGG + Intronic
1160804236 19:984769-984791 GCTCAGGCCTGAGCTGCTATGGG + Intronic
1165069537 19:33247652-33247674 GCTCTGGCCTGGGCTGTTAGGGG + Intergenic
1165468038 19:35986640-35986662 GCCCAGGCCTGAACTTCTGTTGG - Intergenic
925116011 2:1378768-1378790 GTTCGTGCCTGAGCTGCTGTAGG + Intronic
927946323 2:27137290-27137312 GCCCGGGCCTGAGCTGCTGGAGG + Exonic
929818721 2:45257004-45257026 GCCTAGGCCTGAGCTGCAGTTGG - Intergenic
929994865 2:46818913-46818935 GAGCAGGCCTGAGCTTGTATGGG + Intronic
932621124 2:73265457-73265479 CCGCAGGCCTGAGCTGCGAGGGG + Exonic
935385827 2:102499172-102499194 GCTCAGGCCTTAGCTGAGAATGG + Intronic
938422291 2:131154977-131154999 GCTCAGGCGGGAGTGGCTATGGG + Intronic
942603086 2:177661130-177661152 GGTCAGGCCTTAGCTGTTAGAGG + Intronic
944115577 2:196182820-196182842 ACTCAGGACTGAGCTACTAGAGG - Intergenic
945300187 2:208208679-208208701 GATCAGGCATGACCTCCTATGGG - Intergenic
947797217 2:232902026-232902048 GCTCTGGCCCCAGCTGCTAGAGG - Intronic
948059034 2:235030245-235030267 GCTCAGGCCTTCGCTGCCAGTGG - Intronic
948099951 2:235365575-235365597 GCTGAGGCAAGAGCTGCTGTGGG + Intergenic
948205910 2:236162849-236162871 GCTCTGGCCTGAGATGCTGTTGG - Intergenic
948551998 2:238778924-238778946 GCTTTGGCCTGAGCTGGTCTTGG - Intergenic
948909433 2:240995661-240995683 GTTCAGGCCTGAGCTGCCAGGGG - Intergenic
1169569080 20:6887227-6887249 GCTCAGGCCTGGCCTGCCTTGGG + Intergenic
1169839490 20:9919370-9919392 GCTCAGGCTTGTTCTGCTAGTGG - Intergenic
1171083877 20:22217935-22217957 GCTCTGGCCTGAGCAGGTAGTGG + Intergenic
1172834557 20:37864610-37864632 CCTCAGGCCAGAGCTGCTGCTGG - Intronic
1174806245 20:53606715-53606737 GCTCAGCCCTGACCTGCTGTGGG - Intronic
1178538119 21:33427147-33427169 GCTCAGGGCTCAGCCTCTATGGG - Intronic
1178760314 21:35396070-35396092 GGTCAGCCCTGAGCAGCCATGGG - Intronic
1181566899 22:23744328-23744350 GCTCAGGCCTGAGCCAGCATCGG - Exonic
1181693689 22:24582216-24582238 GCTAAGGCATGAGGAGCTATAGG + Intronic
1184066813 22:42125985-42126007 GCTCAGTCCTGGGCTTCCATGGG + Intergenic
1185103066 22:48852009-48852031 GCTCGGGCCTCATCTGTTATTGG + Intergenic
950077008 3:10194436-10194458 GCTCAGGAGTGAGCTGCTCACGG - Intronic
952311126 3:32191318-32191340 GATCAGGCATGACCTCCTATGGG - Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
962468309 3:135681035-135681057 GCTGAGCACTGAGCTGATATGGG + Intergenic
962929365 3:140022807-140022829 GCTCATGCCTTAGCTCCCATGGG - Intronic
967325370 3:188233395-188233417 GCTCAGCTCTGACCTGCTTTGGG + Intronic
968747457 4:2367720-2367742 GCTCAGGCCTGGGGGGCCATGGG + Intronic
969712456 4:8851835-8851857 GCCCAGGCCTGGGCTGCTGGTGG - Intronic
969937462 4:10696433-10696455 GCTAAGGCATGAGATGCTTTAGG + Intergenic
985794400 5:1951696-1951718 GCACAGGCGTCATCTGCTATGGG + Intergenic
989433826 5:41387180-41387202 GCTCAGACCTCAGCTCCTAGAGG - Intronic
992791887 5:80220999-80221021 GCTCAGGGCTGACCTGTTTTGGG - Intronic
1003955842 6:11164396-11164418 CATCAGGCCAGAGCTGCGATGGG + Intergenic
1007462733 6:42030178-42030200 GCTCAGGTTGGAGCTGGTATGGG + Intronic
1011753122 6:90473116-90473138 GCTCAGCCCAGAGGTGCTGTGGG + Intergenic
1012316894 6:97791671-97791693 GCTCAGTCCGGAGCTTTTATGGG + Intergenic
1012425678 6:99111845-99111867 GCGCAGAACTGAGTTGCTATAGG + Intergenic
1017010921 6:150063562-150063584 CCTCAGGTCTGAGCCCCTATGGG - Intronic
1017281715 6:152632962-152632984 GCTCTGCCTTGTGCTGCTATTGG - Intronic
1019352378 7:560676-560698 GCTGAGGCTGGAGCAGCTATGGG - Intronic
1019787032 7:2983603-2983625 GCCTAGGCCTGAACTGCTTTGGG - Intronic
1019925479 7:4189318-4189340 CCTCAGCCTTGAGCTGCGATTGG - Intronic
1021431103 7:20559975-20559997 GCTGAGGCCTGAGCAGATTTTGG - Intergenic
1023806690 7:43877626-43877648 GCTCTGGCCTGAGCCCCTAGGGG - Exonic
1035659170 8:1333914-1333936 GCTCAGCCCTGGGCTGCTGAAGG + Intergenic
1041627597 8:60048296-60048318 GCTCAGGACTGAGCTTCTGAAGG + Intergenic
1041773039 8:61493580-61493602 GCCCAGGCCAGAGCTTCTCTGGG + Intronic
1043218030 8:77620770-77620792 GCTGAGGGCAGAGCTGCAATGGG - Intergenic
1044822236 8:96162020-96162042 GCTCTGCCCTGGACTGCTATGGG + Intergenic
1045264656 8:100608958-100608980 TCTCTTGCCTGAGCTGCTCTGGG + Intronic
1049351525 8:142167256-142167278 GCCCAGGCCTGTGCTGCAGTCGG + Intergenic
1050377564 9:4988222-4988244 GTTCAAGCCTGAGGTGCTCTGGG - Intronic
1051891401 9:21945825-21945847 CCTCAGGCAGGAGCTGCTGTTGG - Intronic
1056711831 9:88997842-88997864 GCTCTGGCCCCAGTTGCTATGGG + Exonic
1057799980 9:98185127-98185149 GCTCAGGCATCAGCTCCTCTAGG + Intronic
1058625687 9:106930756-106930778 GCTCTTTCCTGAGCTGCTTTAGG - Intronic
1060213594 9:121725097-121725119 GGCCAGGCCTGAGCTCCTCTGGG - Intronic
1061130440 9:128705140-128705162 GCTCAGGCCTGAGCTCTAAGGGG + Intronic
1061135619 9:128731677-128731699 GGTCGGGCCTGAGCTGATTTGGG - Intronic
1062401934 9:136376604-136376626 GCTCAGGCGGGAGCTGCTCCAGG + Intronic
1185957276 X:4505039-4505061 GCTCTGGCCTGAGAAGCTCTTGG - Intergenic
1195815172 X:108877281-108877303 GCTGAGGTCTGAGCTGCAAAAGG + Intergenic
1196823279 X:119720906-119720928 GATGAGGCCTGAGCTGGAATAGG + Intergenic
1197342268 X:125288049-125288071 GCTCAGAGCTGACCTGCAATAGG - Intergenic
1200124032 X:153804850-153804872 GCTCAGGCCTGGGCCGGCATCGG + Exonic
1200224819 X:154411668-154411690 GCTCCGGCCTGACCTGCGAAGGG + Exonic