ID: 1160805935

View in Genome Browser
Species Human (GRCh38)
Location 19:992160-992182
Sequence CAGGGCCCGCGGGGTCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160805935_1160805950 16 Left 1160805935 19:992160-992182 CCCGGAAGACCCCGCGGGCCCTG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1160805950 19:992199-992221 TGGTCCTGGCGCCCGTGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 74
1160805935_1160805949 13 Left 1160805935 19:992160-992182 CCCGGAAGACCCCGCGGGCCCTG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1160805949 19:992196-992218 CCTTGGTCCTGGCGCCCGTGCGG 0: 1
1: 0
2: 1
3: 10
4: 97
1160805935_1160805945 2 Left 1160805935 19:992160-992182 CCCGGAAGACCCCGCGGGCCCTG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1160805945 19:992185-992207 CTCCTTCGCTCCCTTGGTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 204
1160805935_1160805944 -4 Left 1160805935 19:992160-992182 CCCGGAAGACCCCGCGGGCCCTG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1160805944 19:992179-992201 CCTGGGCTCCTTCGCTCCCTTGG 0: 1
1: 0
2: 7
3: 21
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160805935 Original CRISPR CAGGGCCCGCGGGGTCTTCC GGG (reversed) Intronic
900337808 1:2173366-2173388 CAGGGACCAGGGGGACTTCCGGG + Intronic
900375110 1:2350673-2350695 CAGGGCCACTGGGGTCTCCCAGG - Intronic
900476852 1:2880090-2880112 CTGTGCCCGGGGGGGCTTCCAGG + Intergenic
901650084 1:10738247-10738269 CAGGGCCGCCTGGGCCTTCCAGG + Intronic
901924052 1:12554761-12554783 CAGGGCCAGCAGGGTCTCCTAGG + Intergenic
904600589 1:31670627-31670649 CAGGGCCCCCCAGGTTTTCCTGG - Exonic
905168873 1:36098608-36098630 CAGGGCCCACAGGGTCTTGGGGG - Exonic
905732372 1:40305740-40305762 CCGGGCCCGCAGGGCCTTCCTGG - Exonic
905733716 1:40312590-40312612 CAGGGCCAGCCCGGGCTTCCTGG - Exonic
905903345 1:41596779-41596801 CAGGGCCCTTGGGGGTTTCCTGG - Intronic
910679106 1:89844058-89844080 CAGTGCTCGGGGAGTCTTCCTGG + Intronic
913546128 1:119871047-119871069 CAGAGCCCTAGGGGTCCTCCTGG - Intergenic
916028444 1:160855676-160855698 CAGGGGCCCGGGGGCCTTCCTGG - Intronic
922744575 1:228037008-228037030 CAGGGCCCGGGGGGACTCCTGGG - Intronic
923299902 1:232630755-232630777 CAGGGCCCGGGGCGCCCTCCGGG - Intergenic
1062774820 10:135850-135872 CAGGCCCCGCGCGGTCCTCCGGG - Intronic
1063099165 10:2934760-2934782 CAGGGGCCCCGGGAACTTCCCGG + Intergenic
1063982907 10:11470271-11470293 GAGGGCCCGCGGGGACTCGCTGG + Intronic
1067551019 10:47236617-47236639 CAGGGACCAGGGGGTCTGCCTGG + Intergenic
1070327987 10:75400345-75400367 CAGCGCCAGCGGGCTCTTCTTGG + Exonic
1070820554 10:79351633-79351655 CAGGGCCTGCTGGGGCTTCCAGG - Intronic
1072706939 10:97687489-97687511 CAGGGCCAGCGCGGTTTTGCTGG + Intergenic
1072914602 10:99530308-99530330 CAGGGCCTGTGAGGACTTCCAGG - Intergenic
1076244708 10:128937711-128937733 CAGGGCCAGCTGTGGCTTCCTGG - Intergenic
1076374291 10:129973015-129973037 CCGGGCCCGTGGGCTCTCCCGGG - Intergenic
1076533139 10:131158942-131158964 CAGTGCCCGTGGGGTCCCCCAGG + Intronic
1076680025 10:132167101-132167123 CAGGGGCAGAGGAGTCTTCCGGG - Intronic
1076734703 10:132453354-132453376 CGGGGCCCGGGGGGTCGTTCCGG + Intergenic
1076776237 10:132699656-132699678 CAGGGCCCGCAGGGTCAGCCAGG + Intronic
1076873033 10:133202858-133202880 CAGGGCCTGAGGGGGCTTCGAGG + Intronic
1076887488 10:133269360-133269382 CCGGGCCCGCGGCTTCTGCCTGG + Intronic
1076930531 10:133528934-133528956 CTGGGCCCGCAGGCTCCTCCCGG + Intronic
1077032848 11:477476-477498 AAGGGCCTGCTGGGTATTCCGGG + Intronic
1077034894 11:489831-489853 CGGGCCCCGCAGGGTCCTCCAGG - Intronic
1077214594 11:1390159-1390181 CGGGGCCCGCGGGGGCGCCCCGG + Intronic
1077365228 11:2158882-2158904 CAGGGCCCGTGGGCCCTTCTGGG + Intronic
1077460980 11:2709347-2709369 CAGGACCTGCGGGGGCTTCCTGG + Intronic
1077505882 11:2929782-2929804 CCGGGCCCGCGGGTGCTTCCCGG - Intergenic
1078932213 11:15921298-15921320 CAGGACCCTCAGAGTCTTCCAGG + Intergenic
1081764355 11:45599187-45599209 CAGTGCCAGCAGGGGCTTCCTGG - Intergenic
1083654856 11:64224673-64224695 CAGGGCCTGCGGTGTCTCCAGGG + Exonic
1083797321 11:65024688-65024710 CAGGGGCCGGGGAGGCTTCCTGG + Intronic
1083933219 11:65857327-65857349 CTGGGCCAGCGAGGCCTTCCCGG - Intronic
1084179653 11:67440004-67440026 CATGGCCCGCCGGGCCTCCCTGG + Intronic
1084588874 11:70078868-70078890 CAGGGCCGGCGCGCCCTTCCCGG - Intronic
1085261434 11:75207516-75207538 CAGGGCCAGAGGGGTTTTCCAGG + Intergenic
1086700572 11:89896778-89896800 GAGGGCGCGCGGTGTCTTGCAGG + Intergenic
1086705597 11:89947748-89947770 GAGGGCGCGCGGTGTCTTGCAGG - Intergenic
1088522078 11:110711682-110711704 CAGGGCCGGCGATGTCTGCCCGG - Intronic
1089307172 11:117533922-117533944 CTGGGCCCTCCGGGTCTGCCTGG - Intronic
1089800660 11:121024302-121024324 CCGGGCCCGCTGGCTCTGCCGGG + Intronic
1091223273 11:133943443-133943465 CTGGGTCCTCGGGGTCTCCCTGG - Intronic
1092278091 12:7077488-7077510 CAGGGCCCTTGGCTTCTTCCTGG + Intergenic
1094199433 12:27780918-27780940 CGTGGCCCTCGGGGACTTCCTGG + Exonic
1095982799 12:47982554-47982576 CAGGGCCCTCCAGGTCTTCAGGG - Exonic
1098105837 12:67068903-67068925 CAGGGCCCGCGGGCGAATCCAGG - Intergenic
1101935425 12:109052856-109052878 CAGGGCCCGCGCGGGCATTCTGG + Intronic
1104079067 12:125414639-125414661 AAGGGCCCGCTGGGACTTCTGGG - Intronic
1104661107 12:130612019-130612041 CAGGCCCTGCGGGCTCTTCAGGG - Intronic
1105223892 13:18409233-18409255 CAAGGCCTGGGGGGCCTTCCCGG - Intergenic
1108350245 13:49585289-49585311 CAGCGCCCGCAGGGACTGCCCGG + Intronic
1111939667 13:94596096-94596118 GAGGAACCGTGGGGTCTTCCCGG - Exonic
1116515542 14:45800659-45800681 CAGGGGCCTCAGGGACTTCCAGG - Intergenic
1120713337 14:87815615-87815637 CAGGCCCCTGGGTGTCTTCCAGG + Intergenic
1121001526 14:90454834-90454856 CAGGGTCCCCGGGGTCTGCGAGG - Intergenic
1121437355 14:93928445-93928467 CGGCTCCCGCGGGGCCTTCCTGG + Exonic
1122124794 14:99573155-99573177 CAGGTCCCGCGGGGACTCCGAGG - Intronic
1122470859 14:101964997-101965019 CAGGGCCTGCCAGGTCCTCCGGG + Intronic
1122843970 14:104480756-104480778 CAGGGCCTGGGGGTCCTTCCTGG - Intronic
1122864414 14:104597072-104597094 CAGCGCCTTCGTGGTCTTCCTGG - Exonic
1129152349 15:73696972-73696994 CAAGGCCTGTGGGTTCTTCCTGG - Intronic
1131459483 15:92608315-92608337 CAGGGCCTGCCTGGTCTTGCAGG - Intergenic
1132660434 16:1058561-1058583 CAGGGCCCGTGGGGGTTTCCTGG - Intergenic
1132852926 16:2032965-2032987 CGGTGCCTGCGGGGGCTTCCGGG + Intronic
1132877773 16:2148076-2148098 CAGCGCCCGCTGTGTCCTCCCGG + Intronic
1132952068 16:2568614-2568636 CAGAGCCAGGGCGGTCTTCCTGG + Intronic
1132962282 16:2631556-2631578 CAGAGCCAGGGCGGTCTTCCTGG - Intergenic
1133025866 16:2988727-2988749 CAGGGCCCTTGCTGTCTTCCGGG + Intergenic
1133198038 16:4184510-4184532 CAGGGCGGGCGGGGTCCCCCGGG + Intergenic
1133324986 16:4936903-4936925 CACTGCCCGGGAGGTCTTCCAGG + Intronic
1135205451 16:20480133-20480155 CAGGGTCCCAGGGGGCTTCCTGG + Intronic
1135213457 16:20543679-20543701 CAGGGTCCCAGGGGGCTTCCTGG - Intronic
1136569063 16:31086165-31086187 CAGGGCCCCCGGAATCTCCCTGG + Exonic
1136779104 16:32885956-32885978 CGGGGCCCGCGGCGGCTGCCCGG + Intergenic
1136891513 16:33975562-33975584 CGGGGCCCGCGGCGGCTGCCCGG - Intergenic
1138559864 16:57795012-57795034 TAGAGCCCGTGGGGGCTTCCGGG + Exonic
1141598648 16:85112395-85112417 CAGGGCCCCAGGGGTCCTGCAGG + Exonic
1142354766 16:89597167-89597189 CGGGGTCTGCGGGGTCTGCCTGG + Exonic
1142358177 16:89613835-89613857 CAGGGGACGCGGCGGCTTCCTGG + Intronic
1142358257 16:89614110-89614132 CAGGGGACGCGGCGGCTTCCTGG + Intronic
1203081519 16_KI270728v1_random:1148044-1148066 CGGGGCCCGCGGCGGCTGCCCGG + Intergenic
1142474547 17:181293-181315 CCGGGCGCGCGGGGGCGTCCGGG + Exonic
1144829754 17:18124575-18124597 CAGGGCCGGCGGGGTCAGCAAGG + Intronic
1144833594 17:18144986-18145008 CAGGGCCAGAGAGGGCTTCCTGG + Intronic
1146522881 17:33539923-33539945 CAGGGACAGCGGAGTGTTCCGGG + Intronic
1148471447 17:47896306-47896328 CGCTGCCGGCGGGGTCTTCCCGG + Intronic
1148647389 17:49226813-49226835 CAGGGCCAGGTGGGTATTCCTGG - Intronic
1148795864 17:50196348-50196370 CAGGGCCCCCGTGGCCTGCCTGG - Exonic
1150790892 17:68199496-68199518 CAGGGGCCGCGGGCACATCCAGG - Intergenic
1151465876 17:74284946-74284968 CAGGTCCCACGGGGGCTCCCAGG - Intronic
1152617760 17:81345811-81345833 CAGGGCCCGCGTCCTCTCCCCGG + Intergenic
1152648796 17:81482470-81482492 CTGGGCTCGGGGGGTTTTCCAGG - Intergenic
1152905791 17:82970247-82970269 CGGGGCCCGTGGGGTATTCACGG - Intronic
1158727064 18:59983303-59983325 CATGGCCTGCCTGGTCTTCCTGG - Intergenic
1160256213 18:77250529-77250551 CATGGCCCGCGGGGCTGTCCCGG - Exonic
1160805935 19:992160-992182 CAGGGCCCGCGGGGTCTTCCGGG - Intronic
1162013299 19:7830627-7830649 CTGGGCCTGCGGGGTCCTCATGG - Intronic
1163126435 19:15246709-15246731 CAGGGCCTGTGGGGGGTTCCAGG + Intronic
1165346825 19:35253857-35253879 CAGAGCCTGGGGGGTCATCCTGG - Intronic
1166125651 19:40714278-40714300 CTGGGGCCGGGGTGTCTTCCTGG + Exonic
1166310430 19:41959335-41959357 CGGGGCCGGCGGGGTCTTCAGGG - Exonic
1167290042 19:48619513-48619535 CTGGGCCCGCCGGGTCCTCCGGG - Exonic
925077087 2:1025728-1025750 CTGGGCCCTCTGGGTCATCCGGG + Intronic
925128372 2:1477410-1477432 CAGGGCCCGCGGGTCTCTCCGGG - Exonic
927250976 2:20994497-20994519 CAGGGATCGGGGGGTCTTCAAGG + Intergenic
929860730 2:45675248-45675270 AGGGGCACGCTGGGTCTTCCTGG - Intronic
930728820 2:54708963-54708985 CAGGCTCCGAGGGGTCTCCCAGG - Intergenic
936288438 2:111199678-111199700 CAGGGCCCGGGGGCCCTGCCGGG + Intergenic
938308129 2:130268258-130268280 CAGGGCAAGCTGGGTGTTCCTGG + Intergenic
938406335 2:131035132-131035154 CAGGGCGCGCAGGGCGTTCCCGG - Intronic
938447202 2:131388578-131388600 CAGGGCAAGCTGGGTGTTCCTGG - Intergenic
942151082 2:173076222-173076244 AAGGTCCCGCGAGGACTTCCCGG - Intronic
943523901 2:188992884-188992906 CAGGGCCCTCCTGGTCCTCCTGG + Exonic
948707104 2:239801665-239801687 CTGGGCCCACGGGCTCTTCCAGG - Exonic
1168898130 20:1338033-1338055 CAGGTCAGGCTGGGTCTTCCTGG - Intronic
1172015635 20:31870817-31870839 CGGGGCCCGCAGGGACGTCCAGG - Intronic
1172437706 20:34941868-34941890 CATGGGCAGAGGGGTCTTCCAGG - Intronic
1172628713 20:36363972-36363994 CAGGGCCAGGGAGGGCTTCCTGG + Intronic
1173207696 20:41007514-41007536 CAGGGGCAGGGGGGCCTTCCTGG + Intergenic
1175215751 20:57391150-57391172 CCGGGCCCGCGGGGGCAGCCAGG + Intergenic
1175817457 20:61890900-61890922 CATGGCACTCTGGGTCTTCCAGG + Intronic
1175824333 20:61928476-61928498 CAAGGCCAGCTGGGTCTCCCAGG - Intronic
1176097385 20:63350363-63350385 CTGGGTACGCAGGGTCTTCCTGG - Exonic
1176310094 21:5144908-5144930 CAGTGCCCGCGGGGACTTGGGGG - Intronic
1176767984 21:13038586-13038608 CAAGGCCTGGGGGGCCTTCCCGG - Intergenic
1178924341 21:36762383-36762405 CGGGGCCCGGGGGGACTTCATGG + Intronic
1178937329 21:36874873-36874895 CAGGGACCGGGGGTGCTTCCTGG - Intronic
1179846962 21:44117124-44117146 CAGTGCCCGCGGGGACTTGGGGG + Intronic
1179912942 21:44459888-44459910 CAGGGCCTCCGGTGTCCTCCTGG - Exonic
1180088849 21:45523759-45523781 CAGGGCCCTGAGGGTCTCCCTGG + Intronic
1181567957 22:23751149-23751171 CCCGGCCCGCGGGCACTTCCGGG + Intergenic
1183315513 22:37135011-37135033 CAGGGCCCCGGGGCTCTCCCTGG + Intronic
950875222 3:16265199-16265221 CTGGGACCGCGGAGTATTCCAGG + Exonic
950968666 3:17164727-17164749 AAGGGCCCAGGGGGTCTACCAGG - Intronic
952152405 3:30607004-30607026 CGGGGCGCCGGGGGTCTTCCTGG + Intronic
952927746 3:38334152-38334174 CAGGGGTCGAGGGGTCCTCCAGG - Intergenic
954136232 3:48583409-48583431 CAGGGCCCACGGGGACCTCCTGG - Exonic
954749673 3:52806428-52806450 CGGGGCCAGGGGGCTCTTCCTGG + Intronic
960939075 3:122921976-122921998 CAGCGCCCGCGCGCTCTTCGTGG - Exonic
962277873 3:134029679-134029701 CGGAGTCCGCGGGGTCTTCCGGG - Intronic
963068680 3:141284223-141284245 CAGGGCCCCAGGTTTCTTCCAGG + Intronic
967924031 3:194632818-194632840 CAGGGCTCGCGGTGTCCTCGGGG + Intronic
968556715 4:1249403-1249425 CCGGGCCCGCAGGGTCCTCGGGG - Intronic
968579295 4:1382476-1382498 CTGGGACCGCGCGGCCTTCCTGG - Intronic
970597641 4:17614706-17614728 CAGGCCCCGCCGGGCCTTCCGGG + Exonic
980956735 4:139436350-139436372 CAGGCCCCGCGGCCTCTCCCTGG - Intergenic
985555501 5:555996-556018 CCGGGCCCTCGGGGTCTGGCTGG + Intergenic
985652401 5:1112932-1112954 CAGGGGCCGCGGGGCACTCCTGG - Intergenic
985972106 5:3386530-3386552 CAGAGCCGGCGTGGTCTTGCTGG + Intergenic
986718528 5:10541261-10541283 CAGGGCCTTCAGGGTCCTCCTGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1001559523 5:172660038-172660060 CAGGGCCCGCGCTGGCTGCCGGG - Intronic
1001640294 5:173239025-173239047 CAGTGCCCACGGGGTGTGCCAGG + Intergenic
1002896787 6:1384223-1384245 CAGGCCCCGCGGGCGCCTCCTGG + Intergenic
1006297102 6:33174561-33174583 CAGGGCAAGCTGGGTGTTCCTGG - Exonic
1007107522 6:39294002-39294024 CAAGGGCGACGGGGTCTTCCTGG + Intergenic
1007397901 6:41587736-41587758 CAGGGCCGCTGGGGTCTTCAGGG + Intronic
1009928633 6:70149848-70149870 CAGGGTCCTCGAGGTCTCCCTGG + Exonic
1011911342 6:92444156-92444178 CAGGGCCTGCGGGGGCTTGGGGG - Intergenic
1017158206 6:151341478-151341500 CAGGACCCCCGGGGGTTTCCTGG + Intronic
1017954829 6:159169306-159169328 CAGGGCCGGCGGGGGCGACCCGG - Intergenic
1019258747 7:68122-68144 CAGGGCCGGCGGGGCCTTGCAGG - Intergenic
1021487914 7:21187375-21187397 CAGTGCCCGCGGGGTCAGCTAGG - Intergenic
1022519702 7:30998295-30998317 CAGGGGCCACGGCTTCTTCCGGG - Intergenic
1023873337 7:44274333-44274355 CAGGGCCCCCAGGACCTTCCAGG + Intronic
1026046084 7:66906040-66906062 CAGGGCCTGCAGAGTCTACCAGG - Intergenic
1026771883 7:73207396-73207418 CAGAGCCCGCCGGGCCTCCCGGG + Intergenic
1027012751 7:74760792-74760814 CAGAGCCCGCCGGGCCTCCCGGG + Intergenic
1027075289 7:75185261-75185283 CAGAGCCCGCCGGGCCTCCCGGG - Intergenic
1029270467 7:99374410-99374432 CACGGCCCCCGGGGACTGCCGGG - Intronic
1029702420 7:102256112-102256134 CAGGGCCCGCGGGCTCTGGCCGG + Exonic
1030262542 7:107580433-107580455 GAGGGCCCGCGGCGCCTTCTGGG + Intronic
1036276373 8:7355090-7355112 CGGGGCCAGCGGGGGCATCCGGG + Intergenic
1036862100 8:12362260-12362282 CGGGCCCAGCGGGGTCATCCGGG - Intergenic
1037654065 8:20867833-20867855 CAGGGCCAGTGGACTCTTCCCGG - Intergenic
1038262437 8:26008079-26008101 CAGGGCCTGGGAGATCTTCCAGG + Intronic
1038455787 8:27671176-27671198 AAGGGCCCCCGGGGTCTCCAGGG + Exonic
1039842267 8:41302752-41302774 CAGGGGCCTTGGGGCCTTCCAGG - Intronic
1041244875 8:55880225-55880247 CGCGGCCCGCGGCGGCTTCCTGG + Intronic
1042801570 8:72723578-72723600 CAGAGCCCACTGGGTCTCCCAGG - Intronic
1043270690 8:78329667-78329689 CAGGGGCCTCAGAGTCTTCCCGG - Intergenic
1045432035 8:102123773-102123795 CCGGGCCTGCGGAGTCTGCCCGG - Intronic
1045520232 8:102896931-102896953 CAGGTCTCCCGGGGTGTTCCTGG - Intronic
1048693150 8:136989904-136989926 CAGGGCCAGGGAGGGCTTCCTGG + Intergenic
1048876058 8:138837724-138837746 CAGGGCCCTCCAGGTCTTCATGG - Intronic
1049711075 8:144063600-144063622 CAGGGCCCTGGGGCTCTTCCAGG - Intronic
1049712095 8:144069567-144069589 CAGGGCCCACTGGGTCACCCGGG + Intergenic
1049746332 8:144264842-144264864 CAGGGCTGGCGGGGTCTGACTGG - Intronic
1049804367 8:144532305-144532327 CAGGGACGTGGGGGTCTTCCAGG + Exonic
1049838168 8:144753827-144753849 CATGGCCCACTGGGCCTTCCAGG + Intronic
1056558029 9:87706220-87706242 CAGCGCCCGTGGGGTCTCCACGG - Exonic
1056579471 9:87880524-87880546 CAGGGTCCTGGGAGTCTTCCTGG - Intergenic
1059438563 9:114290221-114290243 CAGGGCCTGCAGGGGCTGCCAGG + Exonic
1059439799 9:114300658-114300680 CAGGGCCCTCGGGGGCCACCTGG + Exonic
1060966781 9:127716113-127716135 CAGAGGCCTCGGGGTCCTCCTGG + Exonic
1061519276 9:131108086-131108108 CAGGGCCTATGGGGTCTTGCTGG - Intronic
1061840554 9:133356459-133356481 CCGGCCCCGCGGGCGCTTCCGGG + Exonic
1061879469 9:133561515-133561537 CAGGCCCCTGGGGGTCATCCGGG + Intronic
1061945348 9:133905626-133905648 CAGGGCCCTGAGGGTCTTCCAGG - Intronic
1062016545 9:134294038-134294060 CAGGCCCCGCGGAGGCTTGCTGG - Intergenic
1062049240 9:134438599-134438621 CAGGGGCAGCTGGGGCTTCCTGG - Intronic
1062117137 9:134815573-134815595 CAGGGCCCAGTGGGTTTTCCTGG + Exonic
1062302191 9:135880609-135880631 CAGCGACGGAGGGGTCTTCCAGG + Intronic
1062473705 9:136717594-136717616 CAGGGTCCGCTGCATCTTCCTGG + Exonic
1062618928 9:137410923-137410945 CAGGCCCTGGGGGGTCTGCCAGG - Intronic
1187275022 X:17809694-17809716 CAGGGCCCAGGGAGACTTCCAGG + Intronic
1194253158 X:91602943-91602965 CAGGGCCCAAGGGCTCTTCAGGG - Intergenic
1195654868 X:107324334-107324356 CTGGGCCCGGGGTGTCATCCAGG - Intergenic
1196734778 X:118974212-118974234 CACAGTCCGCAGGGTCTTCCGGG - Intergenic
1200100685 X:153688092-153688114 CGGGGCCCGCGGAGGCTGCCCGG - Exonic
1200572098 Y:4844186-4844208 CAGGGCCCAAGGGCTCTTCAGGG - Intergenic