ID: 1160806741

View in Genome Browser
Species Human (GRCh38)
Location 19:995266-995288
Sequence CCTGCTCCTGACCCATCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160806741_1160806748 6 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG 0: 1
1: 0
2: 0
3: 29
4: 218
Right 1160806748 19:995295-995317 GGTGGTGTCCCGATCTGAGCCGG 0: 1
1: 0
2: 1
3: 3
4: 64
1160806741_1160806753 23 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG 0: 1
1: 0
2: 0
3: 29
4: 218
Right 1160806753 19:995312-995334 AGCCGGTCCCCAGAGGGAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 144
1160806741_1160806752 17 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG 0: 1
1: 0
2: 0
3: 29
4: 218
Right 1160806752 19:995306-995328 GATCTGAGCCGGTCCCCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 87
1160806741_1160806751 16 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG 0: 1
1: 0
2: 0
3: 29
4: 218
Right 1160806751 19:995305-995327 CGATCTGAGCCGGTCCCCAGAGG 0: 1
1: 0
2: 1
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160806741 Original CRISPR CCTGCTCCTGACCCATCTGA CGG (reversed) Intronic
900797401 1:4717010-4717032 CTAACTTCTGACCCATCTGACGG - Intronic
901438147 1:9262099-9262121 CGTCCTCCAGAACCATCTGACGG + Exonic
901807143 1:11745691-11745713 CCTGCGCCTGGCACCTCTGAGGG - Intronic
903154419 1:21434429-21434451 CCTGCTGCAGACCCAGCTGGAGG + Intergenic
904009269 1:27380690-27380712 CCTGCTCCTTCCCTCTCTGAGGG - Intronic
904679833 1:32221673-32221695 CCTGCAACTGACCTATCAGATGG + Intronic
905105688 1:35562352-35562374 CCTGGTCCTGCTCCATCTCAAGG + Intronic
905275038 1:36812090-36812112 GCTTCTCCTGACCCATCTGCTGG - Intronic
906141809 1:43538288-43538310 CCTGCTCCTGGCCACTCTGTGGG - Intronic
906689344 1:47782418-47782440 CGTGCTCCCAACCCACCTGAGGG + Intronic
906725149 1:48039221-48039243 CCTGCACTTGACCCATAGGAAGG + Intergenic
907193634 1:52668806-52668828 CCTGCTCCTGACTAACCTCAAGG + Intronic
908021253 1:59901076-59901098 CATGATCCTGACCAATTTGACGG - Exonic
908314649 1:62920808-62920830 CCTTGTCCTGTCACATCTGATGG - Intergenic
913324730 1:117616761-117616783 CCTTCTTCTGACCCTCCTGAGGG - Intronic
914339264 1:146744572-146744594 CCTGCCCCAGACCCTGCTGAGGG + Intergenic
915691742 1:157697261-157697283 CCTGCTCCAGCCCAATCCGAGGG + Exonic
916168298 1:161982393-161982415 CCTCCTCCCGACCCCTCTGTAGG - Intergenic
918433759 1:184489422-184489444 CCTGTTCCTGCCCAATCTGAAGG - Intronic
919000038 1:191818948-191818970 CCTTCCCCAGACCCCTCTGATGG + Intergenic
920244125 1:204575377-204575399 CCTGTGCCTGACCCAATTGAAGG - Intergenic
921301074 1:213752166-213752188 CCTGCTTCTGACCTATCGAAGGG - Intergenic
922749170 1:228062729-228062751 CTTGCTCCTGACCTTTGTGACGG + Intergenic
1063564874 10:7163868-7163890 CCTGCTTCTGACCCTTCCGACGG - Exonic
1068760963 10:60708653-60708675 CCAGATCCTAACCCACCTGAGGG + Intronic
1072307098 10:94118327-94118349 CATACTCCTGAGCCCTCTGAAGG + Intronic
1072806275 10:98425678-98425700 CCTGGTTCTGTCCCAGCTGATGG - Exonic
1073480604 10:103784070-103784092 CCAGCTGCTGACCCAGGTGATGG + Intronic
1074444829 10:113513061-113513083 CCTACTTATGCCCCATCTGAAGG + Intergenic
1075270580 10:121046309-121046331 CCTGCTGCAGACCCACCCGAGGG + Intergenic
1075928980 10:126278078-126278100 CCTGTTCCTCACCCATCAGCAGG - Intronic
1077039069 11:510034-510056 CCTGCTCCACACAGATCTGAGGG + Intergenic
1077176375 11:1192990-1193012 CCTACTTCTCACCCTTCTGAAGG + Intronic
1077365296 11:2159116-2159138 CCTGCACCTGCCCCAGCTCATGG + Intronic
1077456765 11:2686041-2686063 CCTGCCCCTGCCCCATCAGATGG - Intronic
1078510046 11:11978269-11978291 CCTGCTCCTGACCCCACTCCAGG + Intronic
1081585967 11:44383886-44383908 CCTGCTCCTGCCACATAAGATGG - Intergenic
1081760821 11:45575445-45575467 CCTGCCCCTGCCCCAGATGAAGG + Intergenic
1083811249 11:65108134-65108156 CCTGCTCCTGCCCCATCCACCGG + Intronic
1084065058 11:66699296-66699318 TCAGCTCCTGCCCCATCTGTGGG + Intronic
1084731065 11:71073977-71073999 CCGGCTCCTCACGCATCTTATGG + Intronic
1084872967 11:72110025-72110047 CTTGCTCCTGACCCAGTTGATGG - Exonic
1084954267 11:72683179-72683201 GCTGCTCCTGGCCCCTCTGCAGG + Intergenic
1085323062 11:75586622-75586644 CCTGCTCCTGTTTCATCTGCAGG + Intergenic
1089703087 11:120257421-120257443 CCTGCTCCTGCCACATCTCGGGG + Intronic
1092159602 12:6308933-6308955 CCTGCTCCTGGCCCAGCTGGTGG - Intergenic
1092200824 12:6581648-6581670 CCTGCACCTGTCCCACCTGCTGG - Exonic
1092286262 12:7130657-7130679 CCTGCTGCTGCCCCTTCTGCTGG + Exonic
1094188163 12:27667744-27667766 CCTGGGCCTGAGTCATCTGAAGG + Intronic
1096863518 12:54547541-54547563 CCTGCTCCTGATTCATTTTAAGG - Exonic
1097226547 12:57479740-57479762 CCTGCTCCTGAATCTTCTGATGG - Exonic
1102914262 12:116741104-116741126 CCTGCTTCTGTTCCATCTGAGGG + Intronic
1103645139 12:122385828-122385850 ACTGCTCTTCACCCCTCTGAAGG - Intronic
1103826988 12:123746965-123746987 CCTTTTCCTAACCCACCTGAAGG + Intronic
1103976526 12:124706203-124706225 CCTGCCCCTGCCCCACCTCAGGG + Intergenic
1104113050 12:125722079-125722101 CCTGCTCCTGGACAAGCTGATGG + Intergenic
1104705789 12:130946531-130946553 CCTGCCCCTCTCCCATTTGAAGG + Intergenic
1104914341 12:132257082-132257104 CCTGCTCCTGCCACAGCTCAGGG + Intronic
1106371647 13:29140323-29140345 CCTGCTCCTGAAGAATCTCAGGG + Intronic
1112924846 13:104661300-104661322 CATGGTCCTCACCCAACTGAGGG - Intergenic
1113942547 13:114025872-114025894 GCTGCTTCTGACCCAGCTGGAGG - Intronic
1117774972 14:59174433-59174455 CATGCTCATCACCCATTTGATGG - Intergenic
1118637467 14:67760962-67760984 CCAGCTTCTGACCCAGCTGCTGG - Intronic
1119557679 14:75566166-75566188 CCTGCTCCTGACCAATGTGTTGG - Intergenic
1119769693 14:77212807-77212829 CCTGCACCTGACCAACCTGCTGG + Intronic
1120901082 14:89576048-89576070 GCTGTTCCTGACACCTCTGATGG + Intronic
1121456457 14:94041787-94041809 CCTGCTTCTGACCCGGCTGTGGG + Intronic
1121517543 14:94562732-94562754 TCTGCTCCTGCCCCATCAAATGG - Intronic
1121907995 14:97765030-97765052 CCCTCTCCTAATCCATCTGAGGG - Intergenic
1122549684 14:102543333-102543355 CCTGCTCCTGTGCCATCACATGG - Intergenic
1123674066 15:22690648-22690670 CTTGCTCCTGAAGCTTCTGAAGG - Intergenic
1123948569 15:25250662-25250684 CCTCCTCCTGTCCCTTCAGATGG + Intergenic
1124326074 15:28763640-28763662 CTTGCTCCTGAAGCTTCTGAAGG - Intergenic
1125373178 15:39000180-39000202 CCGGGTCCTGCCCCATCTAAGGG - Intergenic
1125909105 15:43420544-43420566 GCTGCTGCTGGCCCTTCTGATGG - Exonic
1126380545 15:48042455-48042477 ACTGCTGCAGACCCTTCTGAGGG - Intergenic
1126909355 15:53401706-53401728 CATGCTCCTGAGAAATCTGAAGG - Intergenic
1127896314 15:63302439-63302461 CGTTCTCCTGACCCACCTGCTGG + Exonic
1129038528 15:72665375-72665397 CCTGCACCTGGCTCATCTGTTGG + Intronic
1129211361 15:74071855-74071877 CCTGCACCTGGCTCATCTGTTGG - Intronic
1129399042 15:75269229-75269251 CCTGCACCTGGCTCATCTGGTGG + Intronic
1129402649 15:75293505-75293527 CCTGCACCTGGCTCATCTGGTGG + Intronic
1129476182 15:75785930-75785952 CCTGCACCTGGCTCATCTGGTGG + Intergenic
1129707379 15:77802469-77802491 CCTGCTCCTGGCCCCTCTGCAGG - Intronic
1129728488 15:77916131-77916153 CCTGCACCTGGCTCATCTGGTGG - Intergenic
1129747656 15:78035954-78035976 ACCCCTCCTGACCCATCTGCTGG + Intronic
1130258421 15:82336629-82336651 CCTGCTCCTTACCCCTTGGAAGG - Intergenic
1130596503 15:85253331-85253353 CCTGCTCCTTACCCCTTGGAAGG + Intergenic
1131425253 15:92340628-92340650 CCTACTCCTGAACCATTTGCGGG - Intergenic
1132799564 16:1745204-1745226 CCTGCTCCTGACCCTCATGGTGG - Intronic
1133527389 16:6618886-6618908 CCTGCTCCTTCCTCATCTAAGGG - Intronic
1134022523 16:10930887-10930909 CCTGCTCCTGAGACACCTGCTGG + Exonic
1135998019 16:27268109-27268131 GCTGCTCCAGCCCCCTCTGAGGG + Intronic
1138826521 16:60327353-60327375 GGTTCTTCTGACCCATCTGAAGG + Intergenic
1139995011 16:70972780-70972802 CCTGCCCCAGACCCTGCTGAGGG - Intronic
1140033905 16:71358822-71358844 CCTGCACCTGGCCGAGCTGACGG + Exonic
1142485864 17:247339-247361 CCTGCTCCTTGCCCAGATGACGG + Intronic
1143026987 17:3946817-3946839 GCTCCTCCTGACCCAGCAGATGG - Intronic
1144063300 17:11602357-11602379 AATCCTCCTCACCCATCTGATGG + Intronic
1144669650 17:17125759-17125781 GATGCTTCTGATCCATCTGAGGG - Intronic
1144810760 17:17997417-17997439 CCTGCTCCTGAAACAGCTGTGGG + Intronic
1146399941 17:32494390-32494412 CCTGCTGCTGACCCTGCAGAGGG - Exonic
1148096308 17:45054744-45054766 CCTACTCCTGACACATCCAAGGG + Intronic
1149455609 17:56785765-56785787 CCTGCTCCTTCCCCACCTCAGGG + Intergenic
1150437937 17:65168472-65168494 TCTGCTCATGGCCCATCTGTTGG + Intronic
1152780877 17:82227027-82227049 CCTGCTCCCCTCCCCTCTGAGGG + Intergenic
1152862492 17:82704124-82704146 TCTGCTCCTGCCCCATGTGAGGG + Intergenic
1155131912 18:22944091-22944113 CCTGCTCCACACCCATCGGAAGG - Intronic
1156457474 18:37302868-37302890 GCTGCTCCTGACCACTCTGAAGG - Intronic
1158401703 18:57127228-57127250 GTTGCTTCTGACCTATCTGATGG + Intergenic
1160806741 19:995266-995288 CCTGCTCCTGACCCATCTGACGG - Intronic
1162015171 19:7841646-7841668 ACTGCTCCTCAGCCATCTGAAGG - Intronic
1162524629 19:11200330-11200352 CCAGCGCCTGCCCCAGCTGATGG - Exonic
1163445073 19:17341248-17341270 CCTGCTGCTGTCCTGTCTGACGG + Exonic
1163638256 19:18447575-18447597 CCTGCTCCTGAGCCATGTGGTGG + Intronic
1167432301 19:49461662-49461684 CCTCCTCCTGGCCCAGCTGGCGG + Exonic
925640482 2:5981842-5981864 GCTCCTCCTGACTCAGCTGAAGG + Intergenic
927142018 2:20137154-20137176 CCTGCTCCTGACACTCCTGGGGG + Intergenic
927243653 2:20939879-20939901 CCTGCTCCAGACACGTATGATGG + Intergenic
927329507 2:21845529-21845551 GCTGCTTCTGACTCATCTGAAGG + Intergenic
928935240 2:36669491-36669513 CTGTCTCCTGACCCATCTGAGGG + Intergenic
933656791 2:84895177-84895199 TCTGCTGCTGACACATCTCAGGG + Intronic
933750551 2:85600100-85600122 GGTGCTCCTGCCCCTTCTGAGGG + Intronic
934689978 2:96351002-96351024 CCTGCTCCTGACCCAGCCTTAGG + Intronic
937152326 2:119694587-119694609 CCTCCTCCTGGCCCCTTTGAAGG + Intergenic
937491931 2:122378738-122378760 ACTGCTCCTTTCCCATTTGATGG - Intergenic
937680962 2:124644131-124644153 CCACCTCCTCACCCATCTAAAGG + Intronic
939887428 2:147696244-147696266 CCTGCTCATTACTCCTCTGATGG - Intergenic
940048699 2:149437738-149437760 CCTGCTCCTGAGCCTGCTGGCGG + Exonic
945140943 2:206685624-206685646 CCTGCCCCTCACCCACCTGAGGG - Intronic
945917881 2:215723454-215723476 CCTTCTCATGACCCTTCTCATGG + Intergenic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1170643335 20:18175422-18175444 GCAGCCCCTGACCCATCTGTGGG + Intronic
1171145579 20:22778596-22778618 TTTGCTACTGCCCCATCTGAAGG - Intergenic
1172008217 20:31831626-31831648 CCTGTTCCCTACCCCTCTGAAGG + Intronic
1172037425 20:32019523-32019545 CCTGCACCTGCCCCACCTAATGG + Intronic
1174617041 20:51843612-51843634 CCTGCCTCTGATCCATCTCAAGG - Intergenic
1174723787 20:52840304-52840326 CCAGCTCCAGATCCATTTGATGG + Intergenic
1174985733 20:55449619-55449641 CCTGTTCCCAACCCAACTGATGG - Intergenic
1175023869 20:55880800-55880822 CCTCCTCCTGGCCGCTCTGAAGG - Intergenic
1177155282 21:17495011-17495033 CCAGCTCCTCACCCCTCCGATGG + Intergenic
1179489341 21:41730043-41730065 CCTGCCTCTGACCCCTCAGATGG - Intergenic
1179626077 21:42650312-42650334 CCTGCTCCTGGCCCGGCTGTCGG - Intergenic
1181341277 22:22182042-22182064 CCTGCTGCTGAGCCCTCTGTGGG + Intergenic
1181410469 22:22714873-22714895 CCTGCTCCTGCTCCATCCTACGG + Intergenic
1181685175 22:24523170-24523192 CCTGCTCCTTACACATGTGTGGG + Intronic
1181766937 22:25098917-25098939 CTTTCTCCTGACCCAGCTGGAGG - Intronic
1182084252 22:27550692-27550714 CCTCCACCTGACCCAGCAGAGGG + Intergenic
1183459407 22:37940912-37940934 CTTCCTCCTGACTGATCTGAGGG - Exonic
1184821081 22:46909694-46909716 CCTGCTCCTGACCCTTTTGGGGG + Intronic
1185241330 22:49749219-49749241 CCTGCTCCAGACCCAGCTTCTGG + Intergenic
949100742 3:141928-141950 CTTTCTCCTGAACCATTTGAGGG + Intergenic
950458145 3:13104777-13104799 CTGGCCCCTGACCCATGTGAGGG + Intergenic
951734586 3:25850223-25850245 ACTGCACTTGGCCCATCTGAAGG + Intergenic
953665106 3:44920191-44920213 CATGCTCATGACCCACATGAAGG - Intronic
953933639 3:47020796-47020818 CCTGCTCCCCACCCATCTCCTGG + Intronic
954318054 3:49811977-49811999 CCTGCTCCAGCCCCATGTGGTGG - Exonic
954445714 3:50545833-50545855 CCTCCTCCTGCCCCCTTTGAGGG + Intergenic
955837273 3:63070024-63070046 CCTCCTACTGACCCAGCTAAAGG + Intergenic
959832727 3:110883611-110883633 TCTGTTCCTGACCCATCTTTTGG + Intergenic
960054118 3:113264592-113264614 TCTGCATCTGCCCCATCTGATGG + Intronic
961306351 3:125960815-125960837 GCAGCTCCTGACCCACCAGATGG - Intergenic
961332493 3:126150956-126150978 CCTGCTTCTTCCTCATCTGAAGG - Intronic
961651370 3:128418214-128418236 CCCGCTCATGACCCAGCTCACGG + Intergenic
961664944 3:128489034-128489056 CCTGCCCCCGACCCACCTGGGGG - Intronic
962303900 3:134269094-134269116 ACTGCGCCTGGCCCATGTGATGG - Intergenic
965694523 3:171393503-171393525 CCTCCTCTTGAACCATATGATGG + Intronic
966734103 3:183175352-183175374 CCTGCTGCTTACACATCTGTAGG - Intergenic
968663707 4:1809677-1809699 CCTGCTCTTGAGCCAGCAGAGGG - Intergenic
969249367 4:5956923-5956945 CCTGCCCCTGGAGCATCTGATGG + Intronic
970905040 4:21205802-21205824 CATGCTCCTAACCACTCTGAGGG + Intronic
972731779 4:41801837-41801859 ACTGCACCTGGCCAATCTGATGG + Intergenic
973180940 4:47266535-47266557 CCTGCTCCTGACCGATCTTTGGG - Intronic
974405320 4:61460777-61460799 ACTGCGCCTGGCCGATCTGATGG - Intronic
975563132 4:75725413-75725435 CCTGCTCCTGTCCCATCAACTGG + Intronic
979807374 4:124991202-124991224 AATAATCCTGACCCATCTGAGGG - Intergenic
980330930 4:131410200-131410222 CCTGCTACTTAACCATCTGTGGG - Intergenic
985705610 5:1399923-1399945 CTTGCTCCTGCCCCATGTGCAGG + Intronic
985968065 5:3352763-3352785 CCTCCTCGTGACCTTTCTGAAGG - Intergenic
986480383 5:8180839-8180861 CCTGCCCTTGACCCTTCTGTTGG + Intergenic
986667678 5:10117450-10117472 CCTGCTCCTGACCCCCTTCAAGG + Intergenic
989032644 5:37135543-37135565 ACTGCACCTGGCCAATCTGATGG - Intronic
989988578 5:50733331-50733353 CTTGCTCCTGACCTAACAGATGG + Intronic
990572789 5:57095464-57095486 CCTAGCCCTGCCCCATCTGATGG + Intergenic
991148645 5:63338971-63338993 CCTTCTCCTGAGTCTTCTGAGGG - Intergenic
993667161 5:90713569-90713591 CCTGCTCCTGCCTCATCTAAAGG - Intronic
997377422 5:133407100-133407122 GCTGCTCCTCACCCACCTCAGGG + Intronic
997733843 5:136199395-136199417 CCTGCTCCTGAACCCTAGGAAGG - Intergenic
997860845 5:137414349-137414371 CCTTCTGCTGAGCCATCTGCAGG + Intronic
1000199051 5:158989355-158989377 GCTGCTCCTGAGCCAAATGATGG + Intronic
1001778053 5:174343966-174343988 CTTGCTCCTCACCAATATGAGGG - Intergenic
1002401058 5:178991792-178991814 TCTGCTTCTGCCCCAACTGAGGG + Intronic
1002415541 5:179119133-179119155 ATTGCTCCTGACCCATCTCTGGG + Intronic
1002488185 5:179553938-179553960 TCTGCTCCTGTCCTACCTGATGG - Intronic
1005094956 6:22104402-22104424 CCTGCTCCTCCCCCATCTATAGG - Intergenic
1006171389 6:32095415-32095437 CCTGCTCCTCAGAGATCTGAAGG + Intronic
1006513362 6:34533245-34533267 CCAGCCCCAGGCCCATCTGAGGG + Exonic
1007087193 6:39157009-39157031 CCAGCCCCTGACCCAACTGAGGG - Intergenic
1007358600 6:41339672-41339694 ACTGCACCTGACCCAACTCAAGG + Intronic
1007606763 6:43123116-43123138 CCTGGTCCTGAGACATCTGACGG + Intronic
1007765710 6:44158679-44158701 CCAGCCCCTTACCCAGCTGAGGG - Intergenic
1011564239 6:88657936-88657958 CCCAATCCTGCCCCATCTGATGG + Intronic
1016997527 6:149970799-149970821 CCAGATCCTGAGCCAGCTGATGG + Intronic
1017001273 6:149999377-149999399 CCAGATCCTGAGCCAGCTGATGG - Intergenic
1017010995 6:150063896-150063918 CCAGATCCTGAGCCAGCTGATGG - Intronic
1017438835 6:154443371-154443393 CCTGCTCTCTACCCATCAGATGG + Intronic
1017514242 6:155141781-155141803 CCTGCTGCTGGCCCATCTCAGGG - Intronic
1017815041 6:158010449-158010471 CATGCTCCTGATACATCAGAAGG + Intronic
1018463394 6:164020389-164020411 CCTGCTCCCGCCCCAGCTGGGGG - Intergenic
1019555950 7:1631469-1631491 CCAGCTCCTCACCCTTCTTATGG - Intergenic
1020081037 7:5285668-5285690 CCTGCTCTTGTCCCATCTCCTGG - Intronic
1024698648 7:51883416-51883438 CCTGCTCCTGCCCCAGCTTAGGG + Intergenic
1024772748 7:52743718-52743740 GCTCCTGCTGACCCATGTGAGGG - Intergenic
1025197874 7:56946498-56946520 CCTGCTCTTGTCCCATCTCCTGG + Intergenic
1025674074 7:63630437-63630459 CCTGCTCTTGTCCCATCTCCTGG - Intergenic
1026174538 7:67984893-67984915 CCTGCTTCAGACCTATCTAAGGG - Intergenic
1030321325 7:108171385-108171407 ACTGCTCCAGTCCCATCTCAGGG + Intronic
1032191697 7:129769531-129769553 CTGGCTCCTGAGCCATCTGCAGG + Intergenic
1032988567 7:137364938-137364960 CCTGGTCATGACCCCACTGATGG - Intergenic
1034269655 7:149797415-149797437 CCTGCTCCTGCACCAGCTGGCGG + Intergenic
1035677136 8:1463754-1463776 CGTGCTCCAGGCCCATCTGACGG - Intergenic
1036565101 8:9931719-9931741 TCTGCCCATTACCCATCTGATGG - Intergenic
1037071100 8:14650216-14650238 CCTACTCCTGATCCATTTGCTGG - Intronic
1038080172 8:24125919-24125941 CCTCCTCCTGACTCTGCTGAGGG - Intergenic
1039954310 8:42195423-42195445 CCTGCACCTGTCCCATCAGGAGG + Intronic
1044601918 8:94013606-94013628 CTTGCTCCTGATCCATCACAAGG - Intergenic
1046904057 8:119553543-119553565 CCTGGTCCTGACTCAGCAGAGGG + Intergenic
1048000739 8:130377635-130377657 CCTGCTCCAGACACATCTCAGGG + Intronic
1048279567 8:133095079-133095101 CCTGCTGCTGAGCCCTCTCATGG - Exonic
1048792399 8:138115816-138115838 TCTGCACCTCACCCATCAGATGG + Intergenic
1049295335 8:141830465-141830487 CCTGCTACTGACTCAGGTGATGG - Intergenic
1050096749 9:2075112-2075134 CCTGCAGCAGACCCATGTGATGG - Intronic
1053001415 9:34578926-34578948 CCTGCTCCTGTCCCTCCTAAAGG - Intronic
1053350495 9:37410669-37410691 CCTGCTCCAGTCCCTTCTCACGG - Intergenic
1053483814 9:38437062-38437084 CCTTCTCCTTCCCCATCTGTTGG - Intergenic
1056563811 9:87756862-87756884 CCTGCTCCTCATCCACCTCAAGG + Intergenic
1057390810 9:94640032-94640054 CCCGTTTCTCACCCATCTGAGGG + Exonic
1059157949 9:112006354-112006376 TCTGATCCTGCCCCATCCGATGG + Intergenic
1060945310 9:127566920-127566942 CCTGGTCCAGACTCACCTGAGGG - Intronic
1061409274 9:130409908-130409930 GCTGCCCCAGGCCCATCTGATGG + Intronic
1061872907 9:133530163-133530185 GCTGCTCCTGACCCCTTTGCAGG + Intergenic
1186181660 X:6979314-6979336 CCTCCTCCACACACATCTGAAGG + Intergenic
1188358384 X:29221721-29221743 ACTGCGCCTGGCCCATGTGAAGG - Intronic
1189840620 X:45072568-45072590 CCTGCTCCTCACTCATCTGCTGG + Intronic
1190766830 X:53482080-53482102 ACTGCTACTAACCCATCTGATGG + Intergenic
1197693053 X:129523138-129523160 CCTGTGCCTGGCCCCTCTGAGGG - Intronic
1198509943 X:137340484-137340506 CTGGCTCCTGACACATCTAAAGG - Intergenic
1199649810 X:149939802-149939824 CCTGCTCCTCACACCACTGATGG - Intergenic