ID: 1160806741

View in Genome Browser
Species Human (GRCh38)
Location 19:995266-995288
Sequence CCTGCTCCTGACCCATCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160806741_1160806753 23 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG No data
Right 1160806753 19:995312-995334 AGCCGGTCCCCAGAGGGAGTTGG No data
1160806741_1160806752 17 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG No data
Right 1160806752 19:995306-995328 GATCTGAGCCGGTCCCCAGAGGG No data
1160806741_1160806751 16 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG No data
Right 1160806751 19:995305-995327 CGATCTGAGCCGGTCCCCAGAGG No data
1160806741_1160806748 6 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG No data
Right 1160806748 19:995295-995317 GGTGGTGTCCCGATCTGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160806741 Original CRISPR CCTGCTCCTGACCCATCTGA CGG (reversed) Intronic