ID: 1160806748

View in Genome Browser
Species Human (GRCh38)
Location 19:995295-995317
Sequence GGTGGTGTCCCGATCTGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160806741_1160806748 6 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG No data
Right 1160806748 19:995295-995317 GGTGGTGTCCCGATCTGAGCCGG No data
1160806737_1160806748 22 Left 1160806737 19:995250-995272 CCACTGCAGGCTGGGACCGTCAG No data
Right 1160806748 19:995295-995317 GGTGGTGTCCCGATCTGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160806748 Original CRISPR GGTGGTGTCCCGATCTGAGC CGG Intronic