ID: 1160806748 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:995295-995317 |
Sequence | GGTGGTGTCCCGATCTGAGC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160806741_1160806748 | 6 | Left | 1160806741 | 19:995266-995288 | CCGTCAGATGGGTCAGGAGCAGG | No data | ||
Right | 1160806748 | 19:995295-995317 | GGTGGTGTCCCGATCTGAGCCGG | No data | ||||
1160806737_1160806748 | 22 | Left | 1160806737 | 19:995250-995272 | CCACTGCAGGCTGGGACCGTCAG | No data | ||
Right | 1160806748 | 19:995295-995317 | GGTGGTGTCCCGATCTGAGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160806748 | Original CRISPR | GGTGGTGTCCCGATCTGAGC CGG | Intronic | ||