ID: 1160806751 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:995305-995327 |
| Sequence | CGATCTGAGCCGGTCCCCAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1160806741_1160806751 | 16 | Left | 1160806741 | 19:995266-995288 | CCGTCAGATGGGTCAGGAGCAGG | No data | ||
| Right | 1160806751 | 19:995305-995327 | CGATCTGAGCCGGTCCCCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1160806751 | Original CRISPR | CGATCTGAGCCGGTCCCCAG AGG | Intronic | ||