ID: 1160806753

View in Genome Browser
Species Human (GRCh38)
Location 19:995312-995334
Sequence AGCCGGTCCCCAGAGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160806741_1160806753 23 Left 1160806741 19:995266-995288 CCGTCAGATGGGTCAGGAGCAGG No data
Right 1160806753 19:995312-995334 AGCCGGTCCCCAGAGGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160806753 Original CRISPR AGCCGGTCCCCAGAGGGAGT TGG Intronic