ID: 1160807409

View in Genome Browser
Species Human (GRCh38)
Location 19:998569-998591
Sequence TAGGAACTCTTGCTCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160807404_1160807409 4 Left 1160807404 19:998542-998564 CCGGAGGGCAGACACAGTCTCTG No data
Right 1160807409 19:998569-998591 TAGGAACTCTTGCTCCTCAGAGG No data
1160807403_1160807409 5 Left 1160807403 19:998541-998563 CCCGGAGGGCAGACACAGTCTCT No data
Right 1160807409 19:998569-998591 TAGGAACTCTTGCTCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160807409 Original CRISPR TAGGAACTCTTGCTCCTCAG AGG Intergenic