ID: 1160808920

View in Genome Browser
Species Human (GRCh38)
Location 19:1004623-1004645
Sequence CCGGGACCCACGGGGCGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160808910_1160808920 19 Left 1160808910 19:1004581-1004603 CCAGGTACACATGTCTCGGCACT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 15
4: 267
1160808909_1160808920 20 Left 1160808909 19:1004580-1004602 CCCAGGTACACATGTCTCGGCAC 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 15
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160808920 Original CRISPR CCGGGACCCACGGGGCGCCC CGG Exonic