ID: 1160808920

View in Genome Browser
Species Human (GRCh38)
Location 19:1004623-1004645
Sequence CCGGGACCCACGGGGCGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160808910_1160808920 19 Left 1160808910 19:1004581-1004603 CCAGGTACACATGTCTCGGCACT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 15
4: 267
1160808909_1160808920 20 Left 1160808909 19:1004580-1004602 CCCAGGTACACATGTCTCGGCAC 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG 0: 1
1: 0
2: 2
3: 15
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160808920 Original CRISPR CCGGGACCCACGGGGCGCCC CGG Exonic
900094660 1:935420-935442 GAGGGGCCCACCGGGCGCCCGGG - Intronic
900291008 1:1923597-1923619 CAGGGCCCCACGGGGCCCCCAGG - Intronic
901075792 1:6554138-6554160 CCGGGGCCCACGGGCCGCACCGG + Exonic
901660395 1:10795207-10795229 CGGGGATCCAGGGGGCGCGCGGG - Intronic
902067541 1:13700451-13700473 CCGGGGCCCCCGGCACGCCCGGG - Intronic
902457738 1:16548104-16548126 CTGAGAGGCACGGGGCGCCCAGG - Intergenic
902475182 1:16680445-16680467 CTGAGAGGCACGGGGCGCCCAGG - Intergenic
902483473 1:16725190-16725212 CTGCGAGGCACGGGGCGCCCGGG + Intergenic
902494424 1:16859809-16859831 CTGAGAGGCACGGGGCGCCCAGG + Intronic
904597358 1:31655339-31655361 CCGGGGCCTTCGGGGAGCCCTGG - Exonic
904603168 1:31684575-31684597 CCGGGCACCACAGGGCGGCCAGG - Exonic
904822931 1:33256776-33256798 CCCGGGCCCTCGGAGCGCCCCGG - Intronic
905168707 1:36098152-36098174 GCTGGGCCCACGGGGCCCCCAGG - Exonic
905168789 1:36098374-36098396 CCGGGTTTCACGGGTCGCCCTGG - Exonic
906044362 1:42816944-42816966 CTGAGACCCAGAGGGCGCCCAGG + Intronic
906219437 1:44067569-44067591 CCTGGACCCACAGGGAGCACTGG + Intergenic
911092556 1:94029464-94029486 CCGGCACCCTCGGGGCACTCTGG + Exonic
912401486 1:109397501-109397523 CCGGGAGTCGCGGGGCGCACGGG + Intronic
922985551 1:229863699-229863721 CCGGGACACTCGGGCCACCCTGG + Intergenic
1064052298 10:12069153-12069175 CCGCGAGCCCCAGGGCGCCCTGG + Exonic
1064442915 10:15370441-15370463 CCGGGACACAGGGGGCACCCCGG + Intronic
1064552871 10:16520794-16520816 CCCGGCCCCATGGGGCCCCCGGG - Exonic
1065093116 10:22253495-22253517 CCGAGACCCACAGGGGTCCCCGG + Intergenic
1067132111 10:43574372-43574394 CCGGGACACACGTGCCGCCGCGG + Intronic
1067187727 10:44044554-44044576 CCGGTGCCCAGGGAGCGCCCAGG - Intergenic
1069984218 10:72273029-72273051 CTAGGACCCGGGGGGCGCCCGGG + Intergenic
1070570720 10:77637946-77637968 CCGAGAGCCAGGGGGCGCCGCGG + Intronic
1070800743 10:79243248-79243270 CGGGGGCGCACGGGGCGCGCCGG - Intronic
1073137359 10:101227380-101227402 CCGGGGCCTTCGGGGCGCCTGGG + Exonic
1073509770 10:104035518-104035540 CCTGGTCCCCCGGGGCCCCCTGG - Exonic
1075401453 10:122164006-122164028 CCGGGAGACTCGGGGCGGCCCGG - Intronic
1075693640 10:124418427-124418449 CCCGGAACCCCGGGGCGCCTCGG + Intronic
1075724834 10:124605905-124605927 CCGGAACCCACAGGGTGACCCGG - Intronic
1076156746 10:128210799-128210821 CCGGGGCCCCAGGGGTGCCCGGG - Intergenic
1076342648 10:129760111-129760133 ACGGCACCCACGTGGCCCCCAGG - Intronic
1077105947 11:842714-842736 CCGGGAGCCCCGGGACGCACAGG - Intergenic
1077176479 11:1193418-1193440 CCGAGAACCAAGGGGTGCCCCGG + Intronic
1077466839 11:2737393-2737415 CCCAGACCCACGGGGGCCCCTGG + Intronic
1077544872 11:3164974-3164996 GCGGGAGCCTGGGGGCGCCCCGG - Intronic
1079284645 11:19117523-19117545 ACCGGCCCCAGGGGGCGCCCTGG - Intronic
1083207343 11:61160795-61160817 CCGGGACCCTCTGGGCGCAAAGG - Intronic
1083316269 11:61816587-61816609 CCGGCATCCAGGGGGCTCCCGGG - Exonic
1083335044 11:61917368-61917390 CCCGGCGCCTCGGGGCGCCCAGG + Exonic
1083554374 11:63614217-63614239 CCGGGGCCCGGCGGGCGCCCAGG + Exonic
1084423531 11:69072169-69072191 CCGGGAACCACAGAGCGCCAGGG - Intronic
1085011057 11:73142103-73142125 CCGGGCCGCCCGGGCCGCCCGGG - Exonic
1087014577 11:93543095-93543117 TCGGGACCCGCCGGGCGCCCAGG + Intronic
1089560157 11:119339785-119339807 GCGGGACCCGCGGGGCCCACCGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1097051177 12:56224267-56224289 GCGGGACGCAGGGCGCGCCCGGG + Intronic
1101834069 12:108282760-108282782 CTGGGCCCCACGGGACCCCCAGG + Intergenic
1102199420 12:111047126-111047148 CCGGGACCCAGCGGGGGCCGGGG - Intronic
1103085650 12:118060741-118060763 CCGGGACAGAGGGGGCTCCCGGG - Intronic
1104573527 12:129945980-129946002 CCAGGACCCACGGAGCAACCAGG - Intergenic
1104724913 12:131070133-131070155 CAAGGACCCAAGGGGTGCCCAGG - Intronic
1104802139 12:131561030-131561052 CAAGGACCCAGGGGGTGCCCAGG + Intergenic
1104924824 12:132308652-132308674 CCGGGACCCACCTGGCACCTCGG + Intronic
1104945934 12:132414905-132414927 CCCAGACCCACGGGGGCCCCGGG - Intergenic
1105799563 13:23891773-23891795 GCTGGACCCACGGGGCCCCAGGG - Exonic
1105849483 13:24321262-24321284 GCTGGACCCACGGGGCCCCAGGG + Exonic
1108662596 13:52600283-52600305 GCGGGACCCGCGCGCCGCCCAGG - Intergenic
1112509675 13:99998002-99998024 CCGGGACCCACAGGGGCCCTGGG - Intergenic
1113419813 13:110162379-110162401 CCAGGATCCATGGGGCCCCCAGG - Exonic
1113420697 13:110169735-110169757 CCGGGACCCATGGGGCCTCCAGG - Exonic
1113456170 13:110450415-110450437 CCAGGACCCCCCGGGCTCCCTGG + Exonic
1113779641 13:112968850-112968872 GCGGCACCCGCGGGGCTCCCAGG + Intronic
1113779668 13:112968991-112969013 CGGTGACCCGCGGGGCTCCCAGG + Intronic
1113837527 13:113338153-113338175 CCGGGACCCATCGCCCGCCCGGG + Intronic
1114660090 14:24338489-24338511 CGGGGAGCCAGGGGGCACCCTGG - Exonic
1119702138 14:76762389-76762411 CGGGTGCCCACTGGGCGCCCTGG - Exonic
1122464888 14:101925276-101925298 CCGGCCCCGACGCGGCGCCCCGG - Exonic
1122688935 14:103522584-103522606 CCGGGCCCCCCGGCGCCCCCCGG + Intronic
1122719626 14:103715141-103715163 CCGGGGCCCCCGGTGCGCGCGGG - Intronic
1122768165 14:104085546-104085568 CCGGGACCCACCCCGCCCCCAGG + Intergenic
1123676542 15:22714965-22714987 CCTGGACGCACTGGGCCCCCTGG + Intergenic
1123699183 15:22902156-22902178 CCTGGACCCATGGGGGACCCTGG - Intronic
1124328760 15:28789225-28789247 CCTGGACGCACTGGGCCCCCTGG + Intergenic
1127606488 15:60592359-60592381 CCGGCCCCGGCGGGGCGCCCGGG + Intronic
1128453667 15:67821329-67821351 CCGGCACCCTGGGGGCGTCCTGG + Intronic
1130933490 15:88449412-88449434 CTGGGAGCCACTGGGAGCCCAGG - Intergenic
1131831064 15:96354657-96354679 ACGGGTCCGACGGGGCACCCTGG + Intergenic
1132664237 16:1074305-1074327 CCGGGGCCCACGCCGCACCCTGG - Intergenic
1132728470 16:1349005-1349027 CCAGTCCCCACGGGGCTCCCAGG + Exonic
1132928357 16:2445274-2445296 CTGGGACCCACGGAGCCTCCCGG + Intronic
1132994742 16:2817195-2817217 CCCGCCCCCAGGGGGCGCCCCGG + Intronic
1133916472 16:10113371-10113393 CCAGGACCCAAGGGTAGCCCAGG - Intronic
1134024160 16:10941957-10941979 CCTGGACGCACTGGGCCCCCTGG - Exonic
1134644932 16:15858272-15858294 CGGGGACCCGCGGGCAGCCCGGG + Intergenic
1136707776 16:32202916-32202938 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1136760133 16:32726495-32726517 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1136807971 16:33143891-33143913 CGGGGTCCCCCGGGCCGCCCGGG - Intergenic
1137426549 16:48385303-48385325 CCGAGACCGACGGGACACCCTGG + Intronic
1137604929 16:49780972-49780994 CCGGAAGCCAAAGGGCGCCCAGG + Intronic
1138540273 16:57683712-57683734 CCGGAACCCACAGGGCCCCGTGG + Intronic
1140210145 16:72963126-72963148 CGGGGACCCACTGGGTTCCCAGG - Intronic
1140223176 16:73058421-73058443 CGGGGCTCCTCGGGGCGCCCGGG - Intronic
1142030417 16:87835797-87835819 CAGGCACCCCCGGGGCCCCCAGG + Intronic
1142139408 16:88466059-88466081 CCTGCACCCACTGGGAGCCCAGG - Intronic
1203062289 16_KI270728v1_random:986817-986839 CGGGGTCCCCCGGGCCGCCCGGG + Intergenic
1142859050 17:2749788-2749810 CCGGGGCTCTCGGGGCTCCCGGG - Intergenic
1142902039 17:3018216-3018238 CTGGGACCCACTTGCCGCCCCGG - Intronic
1143082745 17:4393881-4393903 CCGGGACCCTCGGCCCTCCCAGG + Intergenic
1144724637 17:17495823-17495845 CCGGCGCTCGCGGGGCGCCCTGG + Intronic
1144758608 17:17694726-17694748 CCGGGACCTTCGGGGCGCTGAGG + Intronic
1145191554 17:20844349-20844371 CGGGGTCCCCCGGGCCGCCCGGG - Intronic
1146823186 17:36000867-36000889 CCGTGACACACGGGGCCCCAAGG - Intronic
1147139598 17:38453809-38453831 CGGGGACCCCCGGGGCCCGCCGG + Intronic
1147139604 17:38453818-38453840 CCGGGGCCCGCCGGCCGCCCGGG + Intronic
1147998715 17:44375534-44375556 CCGGGACCCACGGGGCAGAGGGG - Intronic
1149517781 17:57293357-57293379 CCTGGACCCACGGGGCTGTCAGG + Intronic
1151489740 17:74425808-74425830 CTGGGAGCCACAGGGAGCCCAGG + Intronic
1152178073 17:78800801-78800823 CCTGGGCCCTCGGGGCTCCCTGG - Intronic
1152345464 17:79748272-79748294 CCGGGCCCTGCGGGGCACCCTGG + Intergenic
1152468442 17:80477976-80477998 CAGGGACCCACGGGCAGTCCCGG + Intergenic
1152732231 17:81977923-81977945 TCGGGACCCCCGGGACCCCCGGG - Intronic
1153457330 18:5295588-5295610 GCGCGGCCCCCGGGGCGCCCCGG + Intronic
1155096342 18:22559739-22559761 CAGCGACCCACCGGGCGGCCGGG + Intergenic
1157493038 18:48137048-48137070 CCGGGACCCTGGCGGCGCTCAGG - Intronic
1157701565 18:49764236-49764258 CCAGTGCCCACGGGGCACCCAGG - Intergenic
1160407090 18:78653200-78653222 CCGGGACCGAGGGGGTTCCCGGG - Intergenic
1160407431 18:78654133-78654155 CCGGGACCGAAGGGGTTCCCGGG - Intergenic
1160808920 19:1004623-1004645 CCGGGACCCACGGGGCGCCCCGG + Exonic
1160864467 19:1250782-1250804 CCGGGACCCCCGCAACGCCCTGG - Intronic
1160873531 19:1287257-1287279 CCGGCTCCCACGGGACCCCCAGG - Intronic
1160967901 19:1754540-1754562 CCGGGGCGCACGGGCCGCACGGG + Exonic
1161329562 19:3679788-3679810 GAGGGGCCCAAGGGGCGCCCTGG + Intronic
1161643336 19:5437208-5437230 CCTGTCCCCACGGGGCTCCCAGG + Intergenic
1161714481 19:5867537-5867559 GCGGGACCCATTGGGAGCCCCGG + Exonic
1161871754 19:6875907-6875929 CCGGATCCCATGGGGAGCCCTGG + Intergenic
1162321191 19:9971239-9971261 CAGGGCCCCACGGGGCTGCCCGG - Exonic
1162765960 19:12919512-12919534 CTGGGTTCCACGGGGCGCCCAGG + Intergenic
1162975534 19:14205745-14205767 GCGGCCCCCACGGAGCGCCCGGG - Intronic
1163282080 19:16324502-16324524 CAGGGATCCCCCGGGCGCCCCGG - Intergenic
1166677276 19:44747855-44747877 CCGGGGCCCGCGGGGCACCGGGG - Intronic
1166995117 19:46716417-46716439 CAGGGTCCCCCGGGGCCCCCCGG - Exonic
1167075200 19:47244245-47244267 CCGGAAGCCACGGGGCCGCCCGG - Intergenic
1167498980 19:49835223-49835245 CCGGGCCCCACATGGCCCCCTGG + Intronic
1168199750 19:54805983-54806005 CCGGGCCCCACGGTTCGCGCAGG + Exonic
1168315776 19:55484221-55484243 TCGGGCCCCGCGGGGCTCCCCGG + Exonic
1168315922 19:55484788-55484810 ACTCCACCCACGGGGCGCCCGGG - Intergenic
927209746 2:20631784-20631806 CTGGGACCCACGTGGTTCCCTGG - Intronic
927472400 2:23385838-23385860 CCCGGCCCCACGCGGCGGCCAGG - Intronic
927809724 2:26174185-26174207 CCGGGCCCCACGGGGAGACGAGG - Intronic
928303558 2:30147429-30147451 CCGAGGCCCACGGCGCCCCCTGG + Intronic
930046266 2:47175885-47175907 CCGGGATCCAGGGGGCGCGCGGG - Intronic
932591476 2:73070651-73070673 CCGGGCCCAACCAGGCGCCCGGG + Intronic
935209312 2:100924719-100924741 CCAGGGCCCACGGGGTGGCCAGG - Intronic
935692648 2:105744965-105744987 CCGGGAGGCTCGCGGCGCCCGGG + Exonic
935746544 2:106194243-106194265 CCTGGACCCGCGCGGCTCCCGGG - Exonic
936433239 2:112482166-112482188 CCGGCACCCGGCGGGCGCCCGGG + Exonic
937061326 2:118982353-118982375 CCTGGACTCCCGGGGCTCCCTGG - Exonic
937259639 2:120577173-120577195 CAGGGACCCCCGGGACCCCCAGG + Intergenic
937917490 2:127106232-127106254 CCCGGCCCCACCGGGAGCCCAGG - Intronic
937994352 2:127681458-127681480 CCGGCCACCACGGGGCACCCAGG + Intronic
947148351 2:227088768-227088790 CCTGGACCCATGGGCCCCCCTGG - Exonic
947188033 2:227472336-227472358 CGCGGTCCCACGGGCCGCCCTGG - Exonic
948794232 2:240393950-240393972 CCGGCACCCACAGGGCTCACAGG + Intergenic
948826161 2:240574337-240574359 CCGAGACCTACGGTGCGGCCAGG + Exonic
948910239 2:240999061-240999083 CCCGGGCTCGCGGGGCGCCCGGG + Intronic
1168810738 20:702956-702978 CCAGGACCCACGGAGAGGCCAGG + Intergenic
1169483523 20:6006513-6006535 CCGGGCCCCACTGGCCGCCCGGG - Exonic
1170999246 20:21396766-21396788 CCAGGACCCCCCGCGCGCCCAGG + Intronic
1174268736 20:49351371-49351393 AGGGGACCCAGGGGGCTCCCCGG + Intergenic
1175215703 20:57390850-57390872 CCTGGCCCCACGGAGCGTCCAGG - Intergenic
1175761217 20:61563163-61563185 CAAGGGCCCACGGGGAGCCCAGG + Intronic
1175834921 20:61987326-61987348 CCGGGACCCTCGCGGCTCCTCGG - Intronic
1175896446 20:62337909-62337931 CTGCGACCCTCGGGGAGCCCTGG - Exonic
1175998322 20:62821187-62821209 CTGGGACCCCCGGGGCCGCCCGG + Exonic
1176197113 20:63842489-63842511 CCGTGACCCCCGGGGTGCACAGG + Intergenic
1176301793 21:5102127-5102149 GAGGCACCCACGGGGCTCCCTGG - Intergenic
1176427988 21:6560500-6560522 CCGGGAGCCCCAGGGTGCCCAGG + Intergenic
1179511944 21:41879173-41879195 CCGCGAGCCCCGGCGCGCCCTGG - Intronic
1179703479 21:43168817-43168839 CCGGGAGCCCCAGGGTGCCCAGG + Intergenic
1179801796 21:43814699-43814721 CCTGGTCCCACTGGGAGCCCTGG + Intergenic
1179855238 21:44159773-44159795 GAGGCACCCACGGGGCTCCCTGG + Intergenic
1180085262 21:45505378-45505400 CCGGGCCCCCCTGGGCCCCCTGG + Exonic
1180908347 22:19431513-19431535 CCGGGTCCCTCAGCGCGCCCGGG + Exonic
1181272251 22:21665988-21666010 CCGGGTTCCGCGGCGCGCCCCGG - Exonic
1181522709 22:23458753-23458775 CCAGGAGCCACAGGGCGGCCTGG - Intergenic
1182284009 22:29233429-29233451 CAGGGACCCACTGGGCCTCCAGG + Exonic
1182445650 22:30387757-30387779 CGTGGACCCACGGGGTGGCCAGG + Intronic
1183508666 22:38222816-38222838 CCAGGCCCCACAGGGCACCCAGG + Intronic
1183617567 22:38954765-38954787 CCTGGACCCACAGGGCTCCCAGG - Intronic
1183619496 22:38964423-38964445 CCAGGACCCCCAGGGCTCCCAGG - Intronic
1184155113 22:42662311-42662333 CCGGGACCCAAGGTGGGCACGGG - Intergenic
1184760022 22:46538516-46538538 CGGGGAACCACGGGGGGCCGGGG + Intergenic
1185045770 22:48528065-48528087 CTGGGCCCCCCGGGGCCCCCCGG + Intronic
1185111362 22:48901961-48901983 CCGGCACGGACGGGGCCCCCAGG + Intergenic
1185111547 22:48902807-48902829 CCGGCACGGACGGGGCCCCCAGG - Intergenic
1185310938 22:50153885-50153907 CCGGGCCACACGGGGAACCCTGG + Intronic
1185380342 22:50504940-50504962 CCGGGACCCACGGGCGCCTCTGG - Exonic
1185388811 22:50548233-50548255 CTGGGACCCACGGGGCTCCCGGG - Exonic
949548881 3:5096173-5096195 GCGGAGCCCACGGGGAGCCCAGG + Intergenic
950773724 3:15332443-15332465 CCGCGACCCCCGGGGCGCTCCGG - Exonic
950864176 3:16175610-16175632 CCTGGACCCACGTGGCCTCCAGG + Exonic
954133752 3:48572675-48572697 CCTGGCCCCACGGGGGCCCCTGG - Exonic
954135997 3:48582485-48582507 CCAGGACCCACTGGCCGCCAAGG - Exonic
955406171 3:58627073-58627095 CCAGGACCCAAGGGGCTCCCGGG + Exonic
956631026 3:71316493-71316515 CCGGGCCCCACGTGGGACCCGGG - Intronic
961518944 3:127455942-127455964 CCGGGACTCACGCTGCTCCCAGG - Intergenic
966355095 3:179071594-179071616 CCGGAACCCCCGGGACGCGCCGG + Exonic
966696336 3:182793720-182793742 CCGGGTCCCGCGGGGCGCGGGGG - Exonic
967859603 3:194141296-194141318 CTGGAACCCCCGGGCCGCCCCGG - Intergenic
968509014 4:987261-987283 CCGGGACCCCCTGGCCGCACGGG + Intronic
968583931 4:1407204-1407226 CCGAGACCCACGGAACGCGCGGG - Intergenic
969212209 4:5696481-5696503 CGGGGACCCACGCTGAGCCCAGG + Intronic
973620598 4:52722157-52722179 CCGGGACCCGCGGGACCCGCAGG - Intergenic
983577031 4:169271080-169271102 CCGGGACGCAGCCGGCGCCCGGG + Exonic
985484014 5:139031-139053 CCGGGAGCCACAGGGAGCACCGG + Intergenic
985531678 5:437325-437347 TTGGGACCCAGGCGGCGCCCAGG - Exonic
985547820 5:518908-518930 CAGGTACCCACAGGGAGCCCTGG + Intronic
986316479 5:6592075-6592097 GCGGGTCCCACGGGGTGCTCTGG - Intergenic
989102349 5:37834874-37834896 CAGGGACCCGCAGGGAGCCCAGG - Intronic
992039629 5:72816932-72816954 CCGGGTCCCGCAGGGCGCCTGGG - Intronic
993095468 5:83473943-83473965 CTGGAACGCACGCGGCGCCCTGG + Intronic
995809125 5:116085179-116085201 CCGGGCCCGCCGCGGCGCCCAGG - Intronic
996290974 5:121852063-121852085 CTGGGGTCCAAGGGGCGCCCCGG - Exonic
999767965 5:154755401-154755423 CCGGGAAGCCCGGGCCGCCCCGG + Intronic
1001300966 5:170533467-170533489 CCAGGATCCACGGTGCCCCCAGG + Intronic
1001381688 5:171310059-171310081 CCGTGTCCCACGGGGCGCCACGG + Intronic
1001586013 5:172834350-172834372 CTCGGACCCACGCGGCGCCGCGG + Exonic
1001724960 5:173888815-173888837 CGGGGACCGAGGGGGCGACCTGG - Exonic
1002140223 5:177133508-177133530 CCGGGGCCTACGGGCCGGCCCGG - Intronic
1002692512 5:181059890-181059912 CTGGGATCCAGGGGGCCCCCCGG - Exonic
1003212401 6:4079284-4079306 GCGGGACGCACGGGGCCGCCAGG + Exonic
1003608364 6:7585778-7585800 CCGGGACCCACTGCGGGACCCGG - Exonic
1003608877 6:7590549-7590571 CTGGGACCCGAGGGGCGCCGGGG + Intronic
1003661206 6:8064170-8064192 CCGGGACCCGGGGGTCGGCCCGG + Intronic
1005931764 6:30489907-30489929 CCGGGAGACACGGAGCGCCAGGG + Exonic
1006296580 6:33172573-33172595 CCAGGCCCCCCGGGGCCCCCTGG - Exonic
1006496366 6:34426124-34426146 CCAGGACCCGCGGGGAGCCTGGG + Intronic
1007383291 6:41504140-41504162 CCCTCACCCCCGGGGCGCCCGGG + Intergenic
1007816795 6:44530635-44530657 CCTGGCCCCACGGGGAGCTCTGG + Intergenic
1013170804 6:107634965-107634987 CGGGGCCCGCCGGGGCGCCCGGG - Exonic
1015455728 6:133424543-133424565 CTGGCACCCACGGTGCCCCCAGG - Intronic
1015976390 6:138795830-138795852 CCGCGACCCACGGGACCCCACGG + Intergenic
1018613593 6:165664214-165664236 CCGGGGCACACCGGGAGCCCAGG - Intronic
1018635095 6:165854157-165854179 CTGGGGCCGACGGGGCGCACCGG + Intronic
1018860630 6:167708538-167708560 CCTGGACCCATGGCGGGCCCAGG + Intergenic
1019279222 7:192020-192042 CCTGGACCCAGGGGACGCCAGGG - Intergenic
1019442773 7:1055823-1055845 CCTGGCCTCACGGGGCGCCCAGG - Intronic
1019457454 7:1137993-1138015 CCGGGACGCACCGGCCGCACCGG + Exonic
1019470054 7:1214689-1214711 CCGGGAGCCAGGGGGCACCAAGG + Intergenic
1019472624 7:1229626-1229648 CCGGTCCTCACGGTGCGCCCGGG + Intergenic
1019562216 7:1664757-1664779 CCGGGACCCCCAGCGCGCGCTGG - Intergenic
1019588616 7:1817784-1817806 CCAGGAGCCACAGGGCGGCCTGG + Intronic
1020292008 7:6729681-6729703 CTGGGACCAACGGTGGGCCCTGG + Intergenic
1022105178 7:27192026-27192048 CCGGCAGCCACGGGTGGCCCAGG - Intergenic
1026000423 7:66556543-66556565 CCGGGACCCCACGTGCGCCCCGG + Intergenic
1029180002 7:98693533-98693555 CCTGTACCCACGGTGCACCCAGG - Intergenic
1029620714 7:101688440-101688462 CCGGACCCCACGAGGCGCTCTGG + Intergenic
1032095804 7:128938090-128938112 CCGCCACCCTCGGGGCGCGCCGG - Intronic
1034339242 7:150341402-150341424 CCAGGACCGACGGGGCTCTCCGG - Exonic
1035018535 7:155787316-155787338 CTGGGACCCTCGGGGCAGCCAGG - Intergenic
1035222473 7:157414286-157414308 CCGGGACCCAAGGGACCCCGTGG - Intronic
1035553434 8:545834-545856 TTGGGACCCCCGCGGCGCCCAGG + Intergenic
1040080319 8:43277190-43277212 CCGGGACCCACGGCGCCACGCGG + Intergenic
1040471298 8:47737786-47737808 CCCGGGCCCAAGGGGCGCGCGGG + Exonic
1040471415 8:47738226-47738248 CCGGCACCGCGGGGGCGCCCCGG + Exonic
1040481462 8:47831453-47831475 CTGGGACCCACGGTGCCCCGAGG - Intronic
1044997354 8:97849931-97849953 CCGGGAGCCACGGCCCGCTCTGG - Intronic
1045432043 8:102123792-102123814 CCGGGATCCAGCGGGTGCCCCGG + Intronic
1049194643 8:141308515-141308537 GCGGGAGCCACGGTGCGCGCGGG - Intergenic
1049405358 8:142449852-142449874 TCCGGACCCTCCGGGCGCCCGGG + Exonic
1049538400 8:143193759-143193781 CAGGGCCACACGGGGCACCCGGG - Intergenic
1049792357 8:144477950-144477972 CCGGCTCCCACGGGGCACCGCGG + Intronic
1055501459 9:76906226-76906248 CCAGGAGCCCCGGGGCGCGCCGG + Intergenic
1056922419 9:90802159-90802181 CCGGGCACCCCAGGGCGCCCAGG + Intronic
1057913061 9:99035101-99035123 CCTGGACCCCCTGGGCCCCCAGG + Exonic
1057916106 9:99056359-99056381 CCGGGGCCCCCGGGGCCACCAGG + Exonic
1059438307 9:114289248-114289270 CCGGGACCCCGGGGGTGGCCGGG + Exonic
1060152922 9:121300014-121300036 CCGGGAGCCCCGGGGCCCCCCGG - Intronic
1060661575 9:125408092-125408114 GCGGGACTCACGGGGCGCCCCGG + Intergenic
1060832145 9:126723301-126723323 CTGGGATCGACGGGGCGGCCCGG - Intergenic
1060945608 9:127568267-127568289 CAGGGATCGATGGGGCGCCCCGG - Intronic
1062272132 9:135714450-135714472 CCGCGACCCACCGGGCGGGCGGG - Intronic
1062449262 9:136608679-136608701 CTGGGCCCCACCCGGCGCCCCGG - Intergenic
1062461934 9:136665883-136665905 GCGGGACCCGCGGAGCCCCCGGG + Intronic
1062547467 9:137070133-137070155 CCGGGACCCCACGCGCGCCCCGG - Exonic
1187281473 X:17861011-17861033 CCGGGACGCAGGGGGCGCGCCGG - Intronic
1190337407 X:49270527-49270549 CCGGGACCCAGGCCGAGCCCCGG - Exonic
1190745719 X:53320883-53320905 CCGGGACCCCCACGGCGCGCGGG - Exonic
1192147815 X:68693720-68693742 CCGGGACACACGCGGGGCCTGGG - Intronic
1200075147 X:153547092-153547114 CCGGGACCGACGCAGCGACCTGG - Intronic
1200090327 X:153632975-153632997 CAGGGACCCAGCGGGCTCCCTGG + Intergenic