ID: 1160809457

View in Genome Browser
Species Human (GRCh38)
Location 19:1007166-1007188
Sequence CAGGGTTTTCGGGAGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160809446_1160809457 0 Left 1160809446 19:1007143-1007165 CCTGTGTTGCAGGTGGCGCCCCC No data
Right 1160809457 19:1007166-1007188 CAGGGTTTTCGGGAGAAACAGGG No data
1160809445_1160809457 1 Left 1160809445 19:1007142-1007164 CCCTGTGTTGCAGGTGGCGCCCC No data
Right 1160809457 19:1007166-1007188 CAGGGTTTTCGGGAGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160809457 Original CRISPR CAGGGTTTTCGGGAGAAACA GGG Intronic