ID: 1160809457

View in Genome Browser
Species Human (GRCh38)
Location 19:1007166-1007188
Sequence CAGGGTTTTCGGGAGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160809445_1160809457 1 Left 1160809445 19:1007142-1007164 CCCTGTGTTGCAGGTGGCGCCCC 0: 1
1: 0
2: 1
3: 11
4: 263
Right 1160809457 19:1007166-1007188 CAGGGTTTTCGGGAGAAACAGGG 0: 1
1: 0
2: 0
3: 15
4: 205
1160809446_1160809457 0 Left 1160809446 19:1007143-1007165 CCTGTGTTGCAGGTGGCGCCCCC 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1160809457 19:1007166-1007188 CAGGGTTTTCGGGAGAAACAGGG 0: 1
1: 0
2: 0
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160809457 Original CRISPR CAGGGTTTTCGGGAGAAACA GGG Intronic
900597434 1:3488549-3488571 CAGGCTTTTCTGTAGAAAAATGG + Intergenic
904967656 1:34390876-34390898 CAGGTTTCTCAGCAGAAACAAGG - Intergenic
909223982 1:72993183-72993205 CAGGCTTTGTGTGAGAAACATGG + Intergenic
909792482 1:79696375-79696397 CAGGGTTTGTGTGAGCAACATGG + Intergenic
909793297 1:79701664-79701686 CAGGGTTTGTGTGAGCAACATGG + Intergenic
912146272 1:106798000-106798022 CAGGGTTTTCTTGAGCATCAAGG - Intergenic
914262863 1:146013880-146013902 CAGGGTTTTTAGTAGAGACAGGG + Intergenic
917429864 1:174954827-174954849 CAGGGTTTTAAGCAGTAACAAGG - Intronic
918222134 1:182444688-182444710 AAGGTTGTTGGGGAGAAACAAGG - Intergenic
918222242 1:182445497-182445519 CAGGCTTTGTGTGAGAAACAAGG + Intergenic
920535281 1:206733134-206733156 CAGGCTGTTGTGGAGAAACAGGG - Exonic
920667813 1:207978542-207978564 CAGGCTTTTTAGGAGAAGCATGG + Intergenic
922876990 1:228947802-228947824 CAGGCTTTGTGGGAGCAACATGG - Intergenic
923550928 1:234962574-234962596 CAGTGCTTTCAGGAGAAACTTGG + Intergenic
924662833 1:246037685-246037707 CAGGATTTTGGGGACAAAAAGGG - Intronic
1062930503 10:1349367-1349389 CAGGCTTTGTGGGAGCAACATGG - Intronic
1063054090 10:2484454-2484476 CACGGTTAGGGGGAGAAACAAGG + Intergenic
1063106669 10:2998107-2998129 CAGGCTTTGCGTGAGCAACATGG + Intergenic
1063633093 10:7752908-7752930 CAGGGATTTGGGGGGAGACAGGG + Exonic
1065702378 10:28437915-28437937 CAGGGTTGTTGGGAGAATTAAGG - Intergenic
1067033012 10:42892317-42892339 CAGGGTTCTCCAGAGAAACAGGG - Intergenic
1068084272 10:52355318-52355340 AGGGGTTTTGGGGAGAAATAAGG + Intergenic
1068583648 10:58771843-58771865 AAGGCTTTTGGGGAGAAAGATGG + Intronic
1068750589 10:60587245-60587267 CAGGTGTTTAGGGAGAAACCTGG - Intronic
1069874212 10:71551823-71551845 CAGGGGTTGTGGGAGGAACAGGG - Intronic
1070042986 10:72800566-72800588 CAGGGTTTTTGGAAGATATATGG - Intronic
1070449437 10:76543206-76543228 CAGTGGTGTCGGGAGAGACATGG + Intronic
1070988672 10:80711889-80711911 CAGGGTTCTGGGGGTAAACATGG - Intergenic
1071458319 10:85868319-85868341 CTGGGTGTTTGGGAGCAACAGGG - Intronic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1073616783 10:105004331-105004353 CAGGGTTTAAGGAAGCAACATGG + Intronic
1075022755 10:118963631-118963653 CAGGCTTTTTGCGAGCAACAAGG + Intergenic
1076851421 10:133095309-133095331 GAGGGTTTTCGGGGGAGTCAGGG - Intronic
1077679420 11:4224903-4224925 CAGGCTTTGCGTGAGCAACAAGG + Intergenic
1077682063 11:4251002-4251024 CAGGCTTTGCGTGAGCAACAAGG - Intergenic
1077688838 11:4321487-4321509 CAGGCTTTGCGTGAGCAACAAGG + Intergenic
1078045645 11:7912182-7912204 CAGGGTTTGTGTGAGCAACATGG + Intergenic
1078046443 11:7917499-7917521 CAGGGTTTGTGTGAGCAACATGG + Intergenic
1078090986 11:8264531-8264553 CAGGATTCTGGGGAGAAGCAGGG - Intronic
1078939395 11:15985065-15985087 CAGTGTTTTCGGGAGGAGCGTGG - Intronic
1081628921 11:44674146-44674168 CAGGGGTTCAGGGAGAAAGAGGG + Intergenic
1081662233 11:44895224-44895246 CAGGGTATAGGGGAGAACCATGG - Intronic
1081826322 11:46056792-46056814 CAGGGTTTTCAGGAAGCACAAGG - Intronic
1082856918 11:57816524-57816546 CAGGTTTCTTGGGAGAAAAATGG - Exonic
1083932427 11:65853289-65853311 AAGGGTGTTCCGGAGAATCAGGG - Exonic
1087785792 11:102352601-102352623 CAGGGTTTTTAGTAGAGACAGGG + Intronic
1091929284 12:4382067-4382089 CTGGGTTTCCGAGAGAATCATGG + Intergenic
1093108432 12:15118395-15118417 CAGTGCTTTCCTGAGAAACATGG - Intronic
1093761359 12:22915033-22915055 CAGGCTTTTCTGGAGAAGCTGGG + Intergenic
1096560954 12:52435540-52435562 CAAGGTTAACAGGAGAAACAGGG - Intergenic
1097554612 12:61121700-61121722 CAGGGTTTTCTAGAGGGACAGGG - Intergenic
1097604228 12:61732645-61732667 CAATGTTTTGGGGAGAGACAAGG + Intronic
1097604235 12:61732690-61732712 CAATGTTTTGGGGAGAGACAAGG + Intronic
1099758347 12:86885435-86885457 AAGGGTTTTCTGGAGCAGCAAGG - Intergenic
1100708667 12:97229579-97229601 CAGGGTTCCTAGGAGAAACATGG + Intergenic
1102319994 12:111924894-111924916 CAGGGGTTTGGAGAGAAAGAGGG + Intergenic
1104095978 12:125558401-125558423 CAATGATTTGGGGAGAAACATGG + Intronic
1104257620 12:127154110-127154132 CAGGGCTTGCGGGGGAATCATGG - Intergenic
1106798576 13:33232847-33232869 CAGGGAATTAGGGAGGAACAAGG - Intronic
1108254262 13:48595335-48595357 CAGGCTTTGTGTGAGAAACAAGG - Intergenic
1108803359 13:54127449-54127471 CAGGGTTTGTGTGAGCAACAAGG + Intergenic
1113662170 13:112115030-112115052 CATGATTTTCGGGTGAAACAAGG + Intergenic
1116179353 14:41516267-41516289 CAGGCTTTGCGTGAGCAACATGG - Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1119173710 14:72553997-72554019 CAGCGTTTTCAGGAGATACCTGG - Intronic
1119247859 14:73128484-73128506 CAGGCTTTTTGTGAGCAACAAGG + Intergenic
1121226752 14:92326891-92326913 TAGGGTTGTTGGGAGAAACTGGG + Intronic
1122241646 14:100372213-100372235 CAGGGTTTGTGTGAGCAACAAGG - Intronic
1124599827 15:31124759-31124781 CAGGGTTTTGGGGGAAGACAGGG + Intronic
1124609570 15:31199249-31199271 CAGGCTTTGCGTGAGCAACAAGG - Intergenic
1124610364 15:31203792-31203814 CAGGGTTCTCCAGAGAGACAGGG + Intergenic
1125671978 15:41480373-41480395 CATGGTTTTCTGGGGCAACAAGG + Intronic
1126353546 15:47770896-47770918 CAGGGTCTTCTGGTGAAGCACGG - Exonic
1126621274 15:50642447-50642469 CAGGTTTTACGGGAGAGACCAGG + Intronic
1126874424 15:53024715-53024737 CAGGGTTCTCTAGAGAGACAGGG + Intergenic
1129492901 15:75946713-75946735 CAGGGCTGTCGGGAGGAATAGGG - Intronic
1129775388 15:78233261-78233283 CAGGGTTCTCTGGAGACCCAGGG + Intronic
1131128199 15:89874388-89874410 CAGGCTTTGTGTGAGAAACAAGG + Intronic
1131187003 15:90283264-90283286 CAGTGTTTTAGAGAGAAAAAAGG + Intronic
1132321287 15:100927334-100927356 CAGGCCTTTAGGGAGAATCATGG - Intronic
1132542741 16:518858-518880 CAGGGTTTCCCTGAGACACAGGG + Intronic
1132791517 16:1692067-1692089 CATGTTTTTAGGGAGAATCATGG + Intronic
1132947723 16:2541244-2541266 CACAGTTTTGGGGAGAAACAGGG + Intronic
1132966716 16:2660099-2660121 CACAGTTTTGGGGAGAAACAGGG - Intergenic
1133623995 16:7553032-7553054 CAGATATTTCAGGAGAAACAAGG + Intronic
1133958865 16:10474192-10474214 CAGGGATTGGGGCAGAAACAAGG - Intronic
1136076315 16:27819766-27819788 CAGTGTTTTAGGCAGAAAGATGG + Intronic
1141165035 16:81654660-81654682 CAGGGTCCTTGGGAGAAACTGGG - Intronic
1141696597 16:85623063-85623085 TAGACTTTTCGGGAGAAACTGGG + Intronic
1143333030 17:6151729-6151751 CTGGGGTTTCAGGACAAACATGG + Intergenic
1146293795 17:31632403-31632425 CAGGCTTTTTGTGAGCAACAAGG - Intergenic
1147313358 17:39607435-39607457 CAGGCTTTTTGGGACAACCATGG + Intronic
1147431321 17:40372479-40372501 CAGGGTTTGTGTGAGCAACAAGG + Intergenic
1147597027 17:41724134-41724156 CAGGGTTGTGGGGTGGAACAGGG - Exonic
1147875641 17:43618581-43618603 CAGGGCTTTGGGCAGAAATAGGG + Intergenic
1147915008 17:43880782-43880804 CAGGGTTTTCCGGCGGAACGGGG + Exonic
1148527233 17:48351481-48351503 CAGGGCTTTGGGGGGAAAAAAGG - Intronic
1148568187 17:48646300-48646322 CAGGGTTTCCGGTAGAACGAGGG + Intergenic
1152490563 17:80630412-80630434 CAAGGTTCTCCAGAGAAACAGGG + Intronic
1153125521 18:1785786-1785808 CAGGGTTTGTGTGAGCAACAAGG + Intergenic
1157088194 18:44604099-44604121 CACAGTTTTCAGAAGAAACATGG + Intergenic
1157823395 18:50790288-50790310 CAGGGTTCTACAGAGAAACAAGG + Intergenic
1159883487 18:73882209-73882231 CAGGGTTTTCATTAGCAACATGG - Intergenic
1160784412 19:892851-892873 CAGGGTTTGCGGCGGAAACCTGG - Intronic
1160809457 19:1007166-1007188 CAGGGTTTTCGGGAGAAACAGGG + Intronic
1160884843 19:1341070-1341092 CAGGGGTTTCCAGAGACACAGGG + Intergenic
1165380773 19:35478078-35478100 CATGATTTTTTGGAGAAACAGGG + Intergenic
1167112253 19:47469332-47469354 CCTGGCTTTCAGGAGAAACAGGG + Intronic
1167666007 19:50823141-50823163 CAGGGTTTTCTGGTGAAATTTGG + Intronic
926464391 2:13169295-13169317 CAGGCTTTGTGTGAGAAACATGG + Intergenic
928430014 2:31209572-31209594 GAGGGTTATCAGGAGAGACAAGG - Intronic
931195921 2:60052306-60052328 CAGGGTTCTCCAGAGAGACAGGG + Intergenic
932241507 2:70160916-70160938 CAGGATTTTCTTGAAAAACAGGG - Intronic
936794533 2:116189331-116189353 CAGGCTTTGCGTGAGCAACAAGG + Intergenic
937869086 2:126774935-126774957 CAGGGTTCTGGAGAGAAACTTGG - Intergenic
939033100 2:137100108-137100130 CAGGGTTTTCTCAAGAAAAAAGG - Intronic
940544052 2:155061007-155061029 AAGGGTTCTCCAGAGAAACAGGG + Intergenic
941289489 2:163657970-163657992 CAGGGTTTTCCAGAGAGGCAGGG + Intronic
942689814 2:178573444-178573466 CAGGGTTTTTGGGCGGATCAGGG + Exonic
948333921 2:237193234-237193256 CTGGGTTTTGAGGAGAAAAATGG + Intergenic
948676145 2:239597909-239597931 CAGGGTTCCCGAGAGAAACGGGG + Intergenic
1168736962 20:148975-148997 CTGAGTTTCCGGGAGAAAAAGGG + Intergenic
1169306213 20:4492674-4492696 CAGGGCTTGAGGGAGAAACACGG + Intergenic
1169333681 20:4737484-4737506 CAAGGTTTTTGGCAGAAACCAGG + Intronic
1173379913 20:42530876-42530898 CAGTGGTTTCCGGAGAAACATGG + Intronic
1175340605 20:58227014-58227036 CAGGGTTTGAGGCTGAAACATGG + Intronic
1177299779 21:19227471-19227493 CATGATTTTGGGGAGATACAGGG + Intergenic
1177737916 21:25116048-25116070 CAGGGTTCTCTAGAGAAATAGGG - Intergenic
1178025994 21:28467765-28467787 TAGGGTTCTCCAGAGAAACAGGG - Intergenic
1182301499 22:29339697-29339719 CAGCGCTTTCGGGAGGAGCAAGG + Intronic
949505650 3:4724957-4724979 CAGTGTCTCTGGGAGAAACAAGG - Intronic
951298336 3:20967572-20967594 CAGGCTTTGTGGGAGGAACATGG + Intergenic
951502676 3:23407147-23407169 CAGGGTTCTCAAGAGAAAAAGGG - Intronic
951799069 3:26575128-26575150 CAGGGATCTCTGGAGAAACTGGG - Intergenic
953229438 3:41051577-41051599 CAGGGTTTTCAAGAGACAGAGGG + Intergenic
953839607 3:46378912-46378934 CAGGATTATAGAGAGAAACAAGG - Intergenic
954753530 3:52826934-52826956 CAGGGCCACCGGGAGAAACATGG - Exonic
955386269 3:58483597-58483619 TAGGGTTTTGGGGCGATACAGGG - Intergenic
959956678 3:112246979-112247001 CAGAGTTTTCAGGAGAAAACTGG - Intronic
961641749 3:128369087-128369109 CAGTGCCTTTGGGAGAAACAGGG - Intronic
962248412 3:133818706-133818728 AAAGCTTTTGGGGAGAAACAGGG - Intronic
963658734 3:148095531-148095553 CAGAGGTTTCTGGAGTAACATGG + Intergenic
964316701 3:155452415-155452437 CAGGGTTCTCCAAAGAAACAGGG - Intronic
966691139 3:182742762-182742784 CAGGCTTTTTGTGAGCAACATGG + Intergenic
967495802 3:190144043-190144065 CAGGGTTTGTGTGAGCAACAAGG + Intergenic
967777566 3:193400140-193400162 AAGGGTTTTCCTGAGAAAGAAGG - Intergenic
968472707 4:789380-789402 CACGGTATTCGTGAGAAAAAAGG + Intronic
969343394 4:6556542-6556564 CAGGGTTCTTCAGAGAAACAGGG - Intronic
970532440 4:16998145-16998167 CAGGCTTTGCGTGAGCAACATGG - Intergenic
973252813 4:48078351-48078373 CAGTATTTTGGGGAGAAAAAGGG - Intronic
977062907 4:92277229-92277251 CAGGCTTTGCGTGAGCAACATGG + Intergenic
977867002 4:102040891-102040913 AAGGGTGTTGGGGAGAAAGAGGG + Intronic
978817133 4:112920321-112920343 GATGGTTTTAGGGAGAGACATGG + Intronic
981776556 4:148374841-148374863 CAGTCTTTTTGGGAGATACAGGG - Intronic
982450846 4:155550741-155550763 CAGGGGTTGGGGGTGAAACAGGG + Intergenic
982666748 4:158274209-158274231 CAGGGTTATTTGGAGTAACAAGG + Intergenic
984017906 4:174447558-174447580 CATGGTTTTAGGTAGAAACATGG + Intergenic
985816011 5:2128586-2128608 CAGAATTTTGGGGAGAAACATGG + Intergenic
986193218 5:5515919-5515941 CAGGGTTTGTGTGAGCAACATGG - Intergenic
987141690 5:14953151-14953173 AAGGGTACTCGGGAGAAAGAGGG - Intergenic
987427570 5:17791042-17791064 CAGAGTTTTGGGGAGGAAGACGG + Intergenic
991707192 5:69369470-69369492 CAGGATGTTCGGAAGCAACATGG + Exonic
993092594 5:83444666-83444688 CAGAGTTTTCTGGAGATAGATGG - Intergenic
993258318 5:85622366-85622388 CAGGGGTTCAGGGAGAAACAGGG - Intergenic
994545103 5:101156071-101156093 CAGGCTTTGCGTGAGCAACAAGG + Intergenic
995177618 5:109197222-109197244 AAGGATTTGCGGGAGAAAGATGG + Intergenic
998808973 5:145946883-145946905 CAGTGTTTCCAGTAGAAACATGG + Intronic
1000586106 5:163100895-163100917 CATGGTTTTGAGGACAAACAGGG - Intergenic
1001245500 5:170103135-170103157 CAGTGTTTTCTGGTGAAAAAGGG - Intergenic
1001330975 5:170762112-170762134 CAGGCTTTTTGTGAGCAACATGG + Intergenic
1001333565 5:170779460-170779482 CAGCGTTTTCCAGAGAAACAAGG + Intronic
1001579307 5:172788095-172788117 CAGGCTTTGCGTGAGCAACAAGG - Intergenic
1003911219 6:10745445-10745467 GAGGGTTTTGGGGAGAGAAATGG + Intergenic
1005456877 6:26028845-26028867 CAGGGTTTGTGTGAGCAACAAGG + Intergenic
1005963698 6:30711675-30711697 CAGTGCTTTCTGGAGAATCAGGG - Exonic
1008219441 6:48837690-48837712 CAGGCTCTGTGGGAGAAACAAGG - Intergenic
1009861058 6:69332848-69332870 TAGGATTTTCAGGAGAAACAGGG + Intronic
1013807510 6:114011808-114011830 CAGGCTTTGTGTGAGAAACAAGG + Intergenic
1013808384 6:114017746-114017768 CAGGCTTTGTGTGAGAAACAAGG + Intergenic
1014715237 6:124857022-124857044 CAGGGTTTTCCAAAGAAACAGGG - Intergenic
1015269332 6:131323693-131323715 CAGGCTTTGCGTGAGCAACATGG - Intergenic
1016557724 6:145358444-145358466 CAGGCTTTGCGTGAGCAACAAGG + Intergenic
1017772583 6:157654405-157654427 CAAGGTTCTCTGCAGAAACATGG - Intronic
1019908903 7:4086395-4086417 CAGAGCTTCCGGAAGAAACATGG - Intronic
1020794716 7:12665538-12665560 CAGGATTTGTGGGAGCAACAAGG - Intergenic
1025240958 7:57273655-57273677 CAGGCTCTTCAGCAGAAACATGG - Intergenic
1026439256 7:70429449-70429471 CAGGCTTTTAGGTAGAAACTTGG + Intronic
1027171814 7:75878254-75878276 CAGGGTTATCAGCAGAAAAAGGG + Intronic
1031293194 7:119965733-119965755 TAGGGTTCTCCAGAGAAACAGGG - Intergenic
1031420211 7:121542703-121542725 CTGTATTTTCAGGAGAAACAGGG - Intergenic
1031979376 7:128114923-128114945 CGGGGTTGTCGTGAAAAACAGGG + Intergenic
1034340633 7:150352381-150352403 CAGGGTTTTGGGGACAGAGAGGG - Intergenic
1034352155 7:150423694-150423716 CAGGGGTTTCGGTAGAAGGAGGG - Intergenic
1036600936 8:10259693-10259715 TAGGGTTTCCTGGGGAAACAAGG + Intronic
1037049594 8:14354165-14354187 CAGTGTTTATTGGAGAAACAGGG - Intronic
1037185252 8:16055078-16055100 CAGGGTTTTGGATAGAAACTCGG - Intergenic
1038944710 8:32345797-32345819 CAGGGTTTTTAGTAGAGACAGGG - Intronic
1040796181 8:51292052-51292074 CAGGGTTTTTTGCAGGAACAGGG + Intergenic
1040852558 8:51916225-51916247 CAGGCTTTGTGTGAGAAACAAGG + Intergenic
1041022575 8:53653169-53653191 CAGGGGTTTAGGAAGAAAAAGGG - Intergenic
1041644366 8:60236442-60236464 CAGGGTTCTCCAGAGAAACAGGG - Intronic
1043353173 8:79386137-79386159 CAGGCTTTGTGGGAGCAACATGG + Intergenic
1043353954 8:79391284-79391306 CAGGCTTTGTGGGAGCAACATGG + Intergenic
1044865596 8:96568160-96568182 CAGGCTTTGCTGGAGAAAGAGGG - Intronic
1045315668 8:101041531-101041553 CAGGGTTCCCCAGAGAAACAGGG - Intergenic
1046512579 8:115217925-115217947 CAGGCTTTGTGTGAGAAACATGG - Intergenic
1049906957 9:226704-226726 CAGGCTTTTAGGGTGAATCAAGG + Intronic
1052192518 9:25676331-25676353 CAGGCTTTTTGTGAGCAACAAGG - Intergenic
1055550709 9:77429792-77429814 CTGCCTTTTCAGGAGAAACAAGG + Intronic
1056108550 9:83371958-83371980 CAGGGTTTTCAGGTGAAAGAAGG - Intronic
1203785365 EBV:124588-124610 CAGGGTCTGCAGGATAAACATGG + Intergenic
1186389102 X:9140745-9140767 CAGGGTTTCAGGGGGAAAAAGGG - Intronic
1186459002 X:9733545-9733567 AAGGGATTGTGGGAGAAACAAGG + Intronic
1187556341 X:20355860-20355882 AAGGGTTTTGGGGAGACTCATGG + Intergenic
1188605887 X:32029029-32029051 CAGGGTTGTTGGGGGAAATAAGG - Intronic
1193363652 X:80604630-80604652 CAGGCTTTGCGTGAGCAACAAGG - Intergenic
1194295795 X:92124683-92124705 CAAGGTTTTCAAGACAAACAGGG + Intronic
1194823095 X:98529651-98529673 CAGGCTTTTTGTGAGCAACATGG + Intergenic
1198033602 X:132779775-132779797 TAGGGTTATTGGGAGGAACAGGG - Intronic
1200613297 Y:5349262-5349284 CAAGGTTTTCAAGACAAACAGGG + Intronic
1201298900 Y:12489427-12489449 CAGGGGTTAAGGGAGAAACAAGG - Intergenic