ID: 1160809758

View in Genome Browser
Species Human (GRCh38)
Location 19:1008280-1008302
Sequence GCGGTTACAGAGGTGGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160809745_1160809758 29 Left 1160809745 19:1008228-1008250 CCTGCTCCACGACAAGTGGTACA 0: 1
1: 0
2: 1
3: 2
4: 42
Right 1160809758 19:1008280-1008302 GCGGTTACAGAGGTGGGGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 245
1160809746_1160809758 23 Left 1160809746 19:1008234-1008256 CCACGACAAGTGGTACAAGATGG 0: 1
1: 0
2: 0
3: 5
4: 28
Right 1160809758 19:1008280-1008302 GCGGTTACAGAGGTGGGGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 245
1160809751_1160809758 -2 Left 1160809751 19:1008259-1008281 CCTTGCGGCAAGCGGGTCTTTGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1160809758 19:1008280-1008302 GCGGTTACAGAGGTGGGGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160809758 Original CRISPR GCGGTTACAGAGGTGGGGCA GGG Exonic
900188242 1:1342806-1342828 GCGGTTCTAGAGGTGAGGCCTGG + Intronic
900510970 1:3060954-3060976 GAGGTTACAGAGGGGTGGCTCGG + Intergenic
902394798 1:16126733-16126755 GCAGTTCCGCAGGTGGGGCAAGG + Intronic
903421142 1:23218232-23218254 GCGGTCAGAGAGGTAGGGGAGGG + Intergenic
903516068 1:23911837-23911859 GTGGTTACAGAGCTGGGGCCAGG + Intronic
903742903 1:25568610-25568632 GTGGCTACAGAGCAGGGGCAAGG - Exonic
904025736 1:27502393-27502415 GAGCTTACAGACTTGGGGCAAGG + Intergenic
904976614 1:34461599-34461621 GCAGGGCCAGAGGTGGGGCAGGG + Intergenic
906102890 1:43274361-43274383 CTGGTTTCAGAGGTGGGGCAGGG - Intergenic
906411997 1:45585907-45585929 GAGGTTACAGGCGTGAGGCACGG + Intronic
913611550 1:120514204-120514226 GCAGATGCAGAGGTGGGGCAGGG - Intergenic
913983244 1:143542603-143542625 GCAGATGCAGAGGTGGGGCAGGG + Intergenic
914579642 1:149008035-149008057 GCAGATGCAGAGGTGGGGCAGGG + Intronic
915512238 1:156392673-156392695 GCGGCTGGAGAGGTGGGGGAAGG + Intergenic
915579692 1:156805959-156805981 GCGGTTGCAGAGGAGGTGAAGGG + Intergenic
917453713 1:175168010-175168032 GTGGTTTGAGAGCTGGGGCAAGG - Intronic
918241440 1:182623659-182623681 GCGGCTATAGAGGTGAGTCATGG + Intergenic
919034025 1:192282835-192282857 GGGATTACAGATGTGGGCCATGG + Intergenic
919887312 1:201944231-201944253 GGGGTGAGAGAGGTGAGGCAGGG + Intronic
919919542 1:202160056-202160078 ACGGTTACAGAGGCGGGAGACGG - Intronic
920052456 1:203172091-203172113 GGGGTTTCTGAGATGGGGCAGGG + Intronic
920910267 1:210209933-210209955 GGGATTACAGACGTGGGCCATGG + Intergenic
921947575 1:220896560-220896582 GCGGGGGCGGAGGTGGGGCAGGG + Intergenic
922589664 1:226765213-226765235 CCGGTGTCAGAGGTGGGGCCTGG + Intergenic
1063228973 10:4045084-4045106 CTGGTTAGAGAGGTGGGGTAGGG - Intergenic
1065890698 10:30118771-30118793 GTGGCCACAGAGGTGGGGCCAGG - Intergenic
1065925135 10:30428277-30428299 TCAGTGGCAGAGGTGGGGCATGG + Intergenic
1067056976 10:43058155-43058177 GAGGGTGCAGAGGTGGGGCCTGG - Intergenic
1067083426 10:43226013-43226035 GCGGTGACAGGGGTGGGGGCTGG + Intronic
1071280599 10:84099262-84099284 GGGATTACAGACGTGGGCCACGG - Intergenic
1071528890 10:86374198-86374220 GCGGTCAGAGGGGAGGGGCAGGG + Intergenic
1073105870 10:101031820-101031842 GGGGTTACAGAGGGGGAGCAGGG + Intronic
1073496633 10:103897491-103897513 GCAGTTGCAGATCTGGGGCAGGG + Intronic
1074044112 10:109820809-109820831 GCAGTAACAGAGGTGGCTCAGGG + Intergenic
1077532915 11:3105695-3105717 GGCTTCACAGAGGTGGGGCAGGG - Intronic
1077828143 11:5832553-5832575 GCGGTTACAGAGGCCGGGCTTGG + Intronic
1077939168 11:6821729-6821751 GTGGTTACAGAGGCTGGGGAGGG + Intergenic
1078058725 11:8030102-8030124 TCGGGTATGGAGGTGGGGCATGG + Intronic
1079508398 11:21181470-21181492 ACAGTCTCAGAGGTGGGGCATGG + Intronic
1080864471 11:36180948-36180970 CCAGTAACAGAGATGGGGCAGGG + Intronic
1082047140 11:47738973-47738995 GGGATTACAGATGTGAGGCACGG + Intronic
1083024822 11:59541883-59541905 GCGATTACAGACGTGAGCCACGG - Intergenic
1083459169 11:62799471-62799493 GGGGCAACAGAGGTGGGGCATGG - Intronic
1084431920 11:69115933-69115955 GCCGTTCCTGGGGTGGGGCATGG + Intergenic
1084959629 11:72709733-72709755 GGGGCTCCACAGGTGGGGCAGGG + Intronic
1087747967 11:101971658-101971680 GCGGTTACAGTTGTGAGCCATGG + Intronic
1089362442 11:117899992-117900014 GGGGGTACAGAGGTGGAGCTGGG + Intergenic
1089633347 11:119796933-119796955 GCAGCGACAGAGGTGGGGGAAGG - Intergenic
1089936184 11:122366291-122366313 GGGATGATAGAGGTGGGGCAGGG - Intergenic
1090425186 11:126602669-126602691 GCGGATCCACAGCTGGGGCAGGG - Intronic
1091854783 12:3730822-3730844 GTGGTTACAAGGGAGGGGCAGGG + Intronic
1092210151 12:6640511-6640533 GCTGTCACAGACCTGGGGCAGGG + Exonic
1092258920 12:6942059-6942081 GCGGCCACAGGGGTTGGGCATGG - Exonic
1093405280 12:18797456-18797478 AAGGTTCCAGGGGTGGGGCATGG - Intergenic
1096402084 12:51315649-51315671 GAGGTTAGAGAGGTTGGGCAGGG + Intronic
1097116297 12:56699885-56699907 GGGATTACAGAGGTGAGCCACGG + Intergenic
1097691920 12:62741619-62741641 GGGGTCACAGAGAAGGGGCATGG - Intronic
1099135428 12:78892511-78892533 GTGTTTAGAGAGGTGGGGAAAGG - Intronic
1099963712 12:89422220-89422242 GCTGTTACAGAGGGCGGGCAAGG - Intronic
1100457314 12:94765084-94765106 GTGGTGTCAGAGGTTGGGCAAGG - Intergenic
1100845078 12:98649959-98649981 GTGGTTACTGGGGTGGGGAAGGG + Intronic
1101328265 12:103735925-103735947 GAGGTCACAGTGGTGGGGCTGGG - Intronic
1101707061 12:107230529-107230551 GAGGACACAGATGTGGGGCAAGG + Intergenic
1102075962 12:110060492-110060514 GAGGTGAGGGAGGTGGGGCATGG - Intronic
1105626316 13:22116351-22116373 GGGGTTACAGGGGTGAGCCACGG + Intergenic
1106098112 13:26668384-26668406 GAGGGTACAGAGGTGGGGAGAGG - Intronic
1106673446 13:31932118-31932140 GCTGTTAGAGTTGTGGGGCAGGG - Intergenic
1113642835 13:111970614-111970636 GCTGTTACAGTGCTGGGGCCAGG + Intergenic
1115186732 14:30697197-30697219 CTGATTCCAGAGGTGGGGCAGGG + Intronic
1116806058 14:49494944-49494966 GCTGTGACAGAGCTGAGGCAGGG - Intergenic
1118091009 14:62478201-62478223 GAGGTTATAGAAGAGGGGCAAGG - Intergenic
1119674302 14:76542335-76542357 GCTGCTACGGGGGTGGGGCAGGG - Intergenic
1120171517 14:81250961-81250983 GCGATTACAGGCGTGAGGCATGG - Intergenic
1125603680 15:40928555-40928577 GCGGTCCCTGAGGTGGGGGAGGG - Intergenic
1125994985 15:44150819-44150841 GGGATTACAGACGTGGGCCACGG - Intronic
1128971272 15:72109031-72109053 GGGGTTACAGATGTGAGTCACGG + Intronic
1129611084 15:77058008-77058030 TGGGTTATAGAGGTGGGGCAAGG - Intronic
1130985798 15:88843637-88843659 TCTGCTACACAGGTGGGGCACGG + Exonic
1132313027 15:100870912-100870934 CAGGTTGCAGAGGTGAGGCAAGG - Intergenic
1133255132 16:4512030-4512052 GGGGTGCTAGAGGTGGGGCATGG - Exonic
1133837341 16:9378684-9378706 GCGGTTCCCCAGGTGGGGCCAGG - Intergenic
1134609447 16:15596802-15596824 GAGGTTTCCGAGGAGGGGCAGGG + Exonic
1136405230 16:30041745-30041767 GGGATTACAGAGGTGAGCCATGG + Intronic
1137424406 16:48365617-48365639 CCAGTTACAGAGGTGGAGAAAGG + Exonic
1137792453 16:51186390-51186412 GCGATTACAGGGGTGAGCCACGG + Intergenic
1138657565 16:58499957-58499979 GCAGTGACAGGGCTGGGGCAAGG + Intronic
1139358791 16:66383667-66383689 CAGGTTACAGAGCTGAGGCATGG + Intronic
1141128066 16:81415286-81415308 GTGCTTACTGAGTTGGGGCAGGG - Intergenic
1141213335 16:82001417-82001439 GCGGTGGGGGAGGTGGGGCATGG - Intronic
1142776525 17:2144335-2144357 GCGGTTACAGGCGTGAGCCATGG + Intronic
1144623397 17:16832371-16832393 GCGGTCACTGAGGTGCTGCATGG + Intergenic
1144653775 17:17022583-17022605 GCGGTTACTGAAGTGGGGCTGGG + Intergenic
1144883036 17:18440345-18440367 GCGGTCACCGAGGTGCTGCATGG - Intergenic
1144956420 17:19021074-19021096 ACGGCTACCTAGGTGGGGCACGG - Exonic
1145072605 17:19823684-19823706 TCAGTTAGAGAGGTGGGCCATGG - Intronic
1145149196 17:20504041-20504063 GCGGTCACCGAGGTGCTGCATGG + Intergenic
1145935303 17:28711550-28711572 GCGGTAAGAGGGGCGGGGCAGGG - Exonic
1146102026 17:29992140-29992162 GTGGTTACAGAGGCTGGGAATGG - Intronic
1149454562 17:56777403-56777425 GAGCTTGCAGAGATGGGGCAGGG - Intergenic
1149461915 17:56835160-56835182 CCGGATCCAGTGGTGGGGCATGG - Exonic
1150052419 17:61977859-61977881 GGGATTACAGAGGTGAGCCATGG + Intronic
1150133631 17:62682265-62682287 GCGCTTGCAGATGTAGGGCAAGG - Exonic
1150255302 17:63740036-63740058 GGGATTACAGAGGTGGGCCACGG + Intronic
1150872603 17:68930061-68930083 GGGGTTACAGAGGTTGCCCAAGG - Intronic
1152850175 17:82629214-82629236 GCAGTGCCAGAGGTAGGGCAAGG + Intronic
1154103573 18:11499847-11499869 GAGGTGGCAGAGGTGGGGAAAGG - Intergenic
1156438268 18:37156893-37156915 GCAGATATAGAGGTGTGGCAAGG + Intronic
1156472213 18:37384406-37384428 GAGGACACATAGGTGGGGCAGGG + Intronic
1157083043 18:44549011-44549033 GGGGTTTCAGAGGTGGGGCGGGG + Intergenic
1160809758 19:1008280-1008302 GCGGTTACAGAGGTGGGGCAGGG + Exonic
1161856803 19:6770605-6770627 GGGATTACAGACGTGGGCCATGG - Intergenic
1162909979 19:13843243-13843265 GGGGTTCCAGAGGTGGGATAGGG - Intergenic
1164472068 19:28544673-28544695 CAGCTTACAGAGGAGGGGCATGG - Intergenic
1164520160 19:28972987-28973009 GCAGTCACAGAGCTGGGGCCGGG + Intergenic
1165129344 19:33622311-33622333 GCGGGAACAGGGGTGGGGCAGGG - Intronic
1165608544 19:37129795-37129817 GCTGTTAGAGAAGTGGGACAAGG + Exonic
1165689342 19:37851182-37851204 CCGGTGTCAGAGCTGGGGCATGG + Intergenic
1166310177 19:41958408-41958430 GCGGTTAGACAGCTGGGGCTGGG + Intronic
1166763017 19:45236118-45236140 GAGGTTGGAGAGGTGGGGGAGGG + Intronic
1168243301 19:55097837-55097859 GGGGTTTAATAGGTGGGGCAGGG - Intronic
1168675494 19:58275049-58275071 GTGGTAACTGGGGTGGGGCAGGG + Intronic
925931611 2:8712808-8712830 GTTGTTCAAGAGGTGGGGCACGG + Intergenic
926009272 2:9395511-9395533 GGGATTACAGATGTGGGCCATGG - Intronic
926139181 2:10358345-10358367 GCTGATACGGAAGTGGGGCAGGG + Intronic
928985534 2:37177524-37177546 GTGGTTACAGGGATGGGGAAGGG + Intronic
929563936 2:42973227-42973249 GGGATTACAGACGTGAGGCACGG - Intergenic
929946375 2:46375645-46375667 GAGCTTAGGGAGGTGGGGCAGGG - Intronic
930183820 2:48390972-48390994 GAGGTTACAGGAGTGGGGCAGGG - Intergenic
930540097 2:52694871-52694893 GTGGTAACAGAGGTTGGGGATGG + Intergenic
932077760 2:68681067-68681089 GTGGTTGCAGGGGTGGGACAAGG + Intronic
932270341 2:70403592-70403614 GCTGTTGCAGAGAGGGGGCACGG + Intergenic
933508751 2:83213400-83213422 GGTGTTACAGGGGTGAGGCACGG - Intergenic
933810967 2:86032473-86032495 GGGGTTAGAAGGGTGGGGCATGG - Intronic
934640374 2:96024095-96024117 GAGGTTTCAGAGGTAGAGCATGG + Intronic
934793277 2:97081321-97081343 GAGGTTTCAGAGGTAGAGCATGG - Intergenic
935132591 2:100271687-100271709 GGGGACACAGAGGTGGGCCACGG + Intergenic
937297009 2:120815573-120815595 GAGGCTAGAGAGGTGGGCCAGGG - Intronic
944416602 2:199485378-199485400 AGGGTGACTGAGGTGGGGCAGGG - Intergenic
947976873 2:234374274-234374296 CAGGTTACAGAGGAGGGGCGGGG + Intergenic
948458269 2:238117263-238117285 GCTGTGACAGGGGTGGGGCCAGG + Intronic
948721811 2:239905434-239905456 TCGGCTACCGAGGTGGAGCAGGG + Intronic
948830083 2:240594402-240594424 GGGGCTGCAGAGCTGGGGCACGG + Intronic
1173391612 20:42640093-42640115 GCAGGTACAGAGGTGTGGTATGG - Intronic
1174230186 20:49040008-49040030 GGGGTTACAGGTGTGAGGCACGG - Intergenic
1175588444 20:60166722-60166744 GTGGTTTCAGAGGTGGGCCTGGG - Intergenic
1175828723 20:61950858-61950880 GCGGTTGCAGGGCTGGGGAAGGG - Intergenic
1177199619 21:17939241-17939263 GCAGTTACTGAGGTGGGGGGAGG - Intronic
1178469343 21:32877779-32877801 GGGGTTACAGATGTGAGCCACGG - Intergenic
1178793497 21:35722107-35722129 GTGGTTCCTGAGGAGGGGCAGGG - Intronic
1180384654 22:12169843-12169865 GCGCTTCCAGAAGTGGGGCCTGG + Intergenic
1181953147 22:26569296-26569318 GTGGTTACCCCGGTGGGGCAAGG + Intronic
1183735105 22:39640699-39640721 GCCATAACAGAGGTGGGGAAGGG + Intronic
1184084051 22:42247565-42247587 GTGGTTAGAGAGGCAGGGCAGGG + Intronic
1184478827 22:44735771-44735793 GAGGGGACAGAGCTGGGGCAAGG + Intronic
1185142362 22:49109631-49109653 GGGGCTACAGGGGTGGGGAAGGG - Intergenic
950668984 3:14513936-14513958 GAGGATACACAGGTGGGCCAGGG - Intronic
951556209 3:23923072-23923094 GGGATTACAGATGTGGGCCACGG + Intronic
953272708 3:41460907-41460929 GAGGTTACAGAGGTGGGGAGTGG + Intronic
953411871 3:42695154-42695176 GTGGTGACAAAGTTGGGGCATGG - Intronic
953658209 3:44870991-44871013 GTGGATGCAGAGGTGGGTCAGGG + Intronic
953814626 3:46144410-46144432 GTGGGCACAGAGGTGGGTCATGG - Intergenic
955960854 3:64340076-64340098 GCAGGTACAGAAGTGGGGCTGGG - Intronic
957049362 3:75399421-75399443 CCGGTTGGATAGGTGGGGCATGG - Intergenic
957638381 3:82815871-82815893 GCTGTTCCTGGGGTGGGGCAGGG + Intergenic
960772132 3:121206537-121206559 GGGGTTACAGGCGTGAGGCAGGG - Intronic
962391233 3:134974565-134974587 GGCGTTGAAGAGGTGGGGCAGGG - Intronic
962405643 3:135097544-135097566 GTTGTTAAAGAGGTGGGCCAGGG - Intronic
963771963 3:149396076-149396098 GCGTTCACAAAGGAGGGGCATGG + Intergenic
965572924 3:170189650-170189672 GAGGTCACAGAGCTGGTGCATGG - Intergenic
966339908 3:178914277-178914299 GCAGCTAGAGATGTGGGGCAAGG - Intergenic
969608167 4:8212521-8212543 GCCTTTATAGGGGTGGGGCAAGG + Intronic
970332721 4:15002612-15002634 GCGGCTTCCTAGGTGGGGCAGGG + Intergenic
971784677 4:31084936-31084958 GCGGCTACAGAGGTAGGGCCTGG - Intronic
972758191 4:42073153-42073175 ACGGATACAGAGGCCGGGCACGG - Intronic
973202565 4:47520855-47520877 GAAGTTACAGAGGCCGGGCACGG - Intronic
973299612 4:48565962-48565984 GCTGGCACAGAGGTGGGGCCAGG + Intronic
975728947 4:77319265-77319287 GGTGTTACAGGGGTGGGGCATGG + Intronic
976018356 4:80588183-80588205 GCTGTCACAGAGGTGGGAGATGG + Intronic
978598251 4:110401789-110401811 GTGGGAACAGAGGTGGGGTAGGG + Intronic
980135855 4:128857863-128857885 GCCGCCACAGAGGTGGGCCAGGG - Intronic
982064667 4:151643599-151643621 GTGGTTACAGAGGCTGGGAAGGG - Intronic
982241959 4:153308846-153308868 TAGTTTGCAGAGGTGGGGCAGGG - Intronic
986789453 5:11145650-11145672 AGGATTAGAGAGGTGGGGCAGGG - Intronic
992986822 5:82238862-82238884 GGGGATACAGTGGTGTGGCAAGG + Intronic
993622899 5:90188798-90188820 ACTGTTACAGGGGTGGGGTAAGG - Intergenic
995560326 5:113374160-113374182 GCGGTTACAGGCGTGAGCCACGG + Intronic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
997793060 5:136779926-136779948 GTGGTTACAGAGCTGAGGCTGGG - Intergenic
998041081 5:138951439-138951461 GCTGTAACTGAGGTGGGGCCGGG - Intronic
998179386 5:139925862-139925884 GTGGGTAGAGAGGTGGGGCCTGG - Intronic
1000074119 5:157768980-157769002 GGGATTACAGAGGTGAGCCACGG - Intergenic
1000825476 5:166038687-166038709 GCAGTTCCAGAGATGGTGCAAGG + Intergenic
1001930520 5:175669632-175669654 GGGATTACAGACGTGGGCCACGG + Intronic
1001955175 5:175843908-175843930 GAGGTCTCAGAGGTGGGGCTGGG - Intronic
1003793870 6:9578283-9578305 GGGATTACAGACGTGGGCCACGG - Intergenic
1006653031 6:35567082-35567104 GCGGTTACACTGGTGGGGGGTGG + Intergenic
1007135920 6:39521949-39521971 GATGAGACAGAGGTGGGGCAAGG - Intronic
1007764402 6:44152378-44152400 GCGGTTGCAGTGATGGGGCACGG - Intronic
1008219749 6:48841526-48841548 GCAGTTACAGAGAAGGGGCAGGG - Intergenic
1011240387 6:85266131-85266153 TGGGTTGCAAAGGTGGGGCAAGG + Intergenic
1012132846 6:95518924-95518946 GCGGGTGGGGAGGTGGGGCATGG + Intergenic
1012220642 6:96644954-96644976 GTGGTTACAGAGGCTGGGAAGGG - Intergenic
1012462968 6:99484526-99484548 GAGGTTACAGATGTGAGTCATGG - Intronic
1013074574 6:106759782-106759804 GGGGTTAGAGATGTGGGGAAGGG + Intergenic
1013197942 6:107862404-107862426 GATGATACAGAGCTGGGGCAGGG - Intergenic
1017160910 6:151365361-151365383 GCCTTTACAGAGGTGGGGCTGGG + Exonic
1017615058 6:156237702-156237724 GAGGGTACAGAGTTGGGGGAGGG + Intergenic
1017857403 6:158362618-158362640 GAGGTTACAGATGTGAGCCATGG + Intronic
1018102312 6:160451657-160451679 GCTGTTACAGAGGAGGTGGACGG - Exonic
1018726135 6:166614752-166614774 GAGGTTACAGGGGTGGAGGAAGG - Intronic
1019448343 7:1082980-1083002 GCAGTGACCGAGGTGGGGCTGGG + Intronic
1019473830 7:1234787-1234809 GCGGTTACAGCGTTGGGGGAGGG + Intronic
1020160826 7:5770189-5770211 GGGGTTACAGATGTGAGCCACGG - Intronic
1022030729 7:26489843-26489865 TTGGTTGGAGAGGTGGGGCAGGG + Intergenic
1025185792 7:56857225-56857247 GGGGTTACAGGTGTGGGCCATGG + Intergenic
1025686136 7:63719719-63719741 GGGGTTACAGGTGTGGGCCATGG - Intergenic
1026973622 7:74482680-74482702 GCGGTTATCGTGGTGGGTCAGGG - Intronic
1029112929 7:98222796-98222818 GGGGTGACAGAGGTGGGCCAAGG - Intronic
1029270014 7:99371796-99371818 GGGGTTACAGACGTGAGCCACGG - Intronic
1031462554 7:122069561-122069583 GTTGTTACAGACTTGGGGCAGGG - Intergenic
1032112272 7:129086244-129086266 GGGATTACAGATGTGAGGCACGG + Intergenic
1032798817 7:135301590-135301612 GCAGGTACAGAGCTAGGGCAAGG + Intergenic
1034219288 7:149431714-149431736 GCGGTGTCCGAGGGGGGGCACGG + Exonic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034267698 7:149789225-149789247 GCGGTCACAGAGCAGGGCCAGGG - Intergenic
1034340014 7:150346851-150346873 GGTGTCACAGAGGTGGGGAAGGG + Intergenic
1034474754 7:151275907-151275929 TGGGTGACAGAGGTGGGGCTTGG + Intronic
1035554173 8:553269-553291 GTGGTGACAGTGGTGGGCCAGGG + Intergenic
1035781832 8:2233733-2233755 GCGGGGACTGAGGTGGGGCAGGG + Intergenic
1035810286 8:2485673-2485695 GAGGGGACTGAGGTGGGGCAGGG - Intergenic
1035947436 8:3980973-3980995 GTGGGTACAAAGGTGGGGAAAGG - Intronic
1037315420 8:17595418-17595440 GCGGCTACCTAGGTGGGGCATGG - Intronic
1037576124 8:20204795-20204817 TTGGTTACAGGGGTGGGTCAGGG + Intronic
1038020903 8:23551208-23551230 GCTGGCAGAGAGGTGGGGCAGGG - Intronic
1039876445 8:41590432-41590454 GGGGTTACAGAGCAGGGGCCTGG + Intronic
1039888775 8:41670738-41670760 GGGGTCACACAGGTGGGGAAAGG + Intronic
1041486338 8:58381590-58381612 GTGGTTACAGAGGTGGAGGCTGG - Intergenic
1041618508 8:59936088-59936110 GTGGGTACAAAAGTGGGGCAAGG + Intergenic
1041695544 8:60732395-60732417 GAGGATGCAGAGGTGAGGCAAGG - Intronic
1044629400 8:94263910-94263932 GTGGCTACAGATGTGGGGAAAGG + Intergenic
1044709372 8:95040840-95040862 GCGATTCCAAAGGTGAGGCAGGG - Intronic
1044992383 8:97807573-97807595 GAGGTTACAAAGGTCAGGCATGG + Intronic
1046647365 8:116800874-116800896 GAGGGTTCAGAGGTGGGGCCAGG + Intronic
1048595346 8:135860372-135860394 GAGGTGACAGAAGTGGGACATGG + Intergenic
1048856978 8:138694299-138694321 AGGGGTACAGAGGTGGGGCCTGG + Intronic
1049579384 8:143404509-143404531 GCTGTGACTGAGGTGGGGGATGG - Intergenic
1049646759 8:143739063-143739085 GCGGTCATGGAGGTGGGGCGGGG + Intergenic
1049888733 9:47437-47459 GCGGTGACAGAGGTGGATGAAGG - Intergenic
1052211002 9:25903149-25903171 AAGGTTACAGAGGTAGGTCATGG + Intergenic
1055191080 9:73524825-73524847 GGGATTACAGGGGTGAGGCACGG + Intergenic
1055987385 9:82064946-82064968 GGGATTACAGACGTGAGGCATGG + Intergenic
1056194578 9:84217163-84217185 GATTTTACAGAGTTGGGGCAAGG - Intergenic
1057921977 9:99105114-99105136 GCGGCTAGGGAGGTGGGGCGAGG + Exonic
1059538794 9:115110485-115110507 GGGGTAATGGAGGTGGGGCAGGG + Intronic
1060302658 9:122384362-122384384 GTGGTGCCAGAGGTGGGGGAAGG - Intronic
1060816824 9:126639410-126639432 GCGGGTAGAGGGGTGGGGCATGG - Intronic
1061120693 9:128640634-128640656 GAGGAGACAGAAGTGGGGCAGGG + Intronic
1061970463 9:134042055-134042077 GCTGTTACGAAGGTGGGGCTAGG + Intronic
1186787637 X:12968462-12968484 GGGGTTAAAGAGGAGGAGCATGG + Intergenic
1187344248 X:18448604-18448626 GAGGCCACAGAAGTGGGGCAAGG - Intronic
1189393375 X:40597579-40597601 GCGATTACGGAGCTGGCGCAAGG - Exonic
1189767881 X:44390661-44390683 GGGGGTAGAGAGGTGGAGCATGG + Intergenic
1191920528 X:66251916-66251938 GCTGTTGCAGAGATGTGGCATGG + Intronic
1192150404 X:68708807-68708829 CTGGATACAGAGGTAGGGCAAGG + Intronic
1193036420 X:76956430-76956452 GCAGTTAGAGAGAAGGGGCAAGG - Intergenic
1195026125 X:100879458-100879480 GAGGTTTCAGATTTGGGGCATGG - Intergenic
1196345268 X:114648455-114648477 GGGATTACAGAGGTGAGTCACGG - Intronic
1200054980 X:153455510-153455532 GCGGTTAGAGGGGAGGGGAAGGG + Intronic
1201281358 Y:12345267-12345289 GAAGTTTCAGAGGTAGGGCAGGG - Intergenic
1201281363 Y:12345292-12345314 AAGGTTTCAGAGGTAGGGCAGGG - Intergenic
1201502268 Y:14658131-14658153 GCTGTTACTGAGGGGGGACAAGG - Intronic
1201674875 Y:16569912-16569934 GTGGTTACGGAGCTGGAGCAGGG + Intergenic