ID: 1160810216

View in Genome Browser
Species Human (GRCh38)
Location 19:1010052-1010074
Sequence GCAGTGAACCGTCCTGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160810216_1160810220 11 Left 1160810216 19:1010052-1010074 CCATCCTCAGGACGGTTCACTGC 0: 1
1: 0
2: 0
3: 36
4: 84
Right 1160810220 19:1010086-1010108 GACCCCTCCAGAACCTTCCGCGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160810216 Original CRISPR GCAGTGAACCGTCCTGAGGA TGG (reversed) Exonic
900630200 1:3631044-3631066 GAAGTGATCCTTGCTGAGGAGGG + Exonic
907964725 1:59318050-59318072 GCAGTGGAGCATCCTGAGAAAGG + Intronic
916632373 1:166630446-166630468 GAAGTAAAGTGTCCTGAGGAAGG - Intergenic
923123995 1:231019910-231019932 GCAGTGACAAGTCCCGAGGAGGG + Exonic
1070793825 10:79205378-79205400 GCAGTTAACTGTCCAAAGGATGG - Intronic
1074729021 10:116348816-116348838 ACAGTCAACGGTCCTGAGGCAGG - Intronic
1075108964 10:119562343-119562365 GGAGTGAACCGTCTGGAAGAGGG + Intergenic
1075319226 10:121476698-121476720 GCAGAGAAGCTCCCTGAGGAGGG + Intergenic
1076246223 10:128949659-128949681 GCAGTGGACAGTCCAGAGCATGG + Intergenic
1078668376 11:13344296-13344318 GCAGTCAAGTGTCTTGAGGAAGG - Intronic
1083095950 11:60251654-60251676 GCAGCAAAGTGTCCTGAGGACGG - Intergenic
1083263922 11:61537523-61537545 GCAGGCAGCCGTCCTGAGCAAGG - Intronic
1083406627 11:62461845-62461867 GCCGTGAACTATCCTGTGGAAGG - Intronic
1085888618 11:80550933-80550955 GCAGGGAATCGACTTGAGGAGGG + Intergenic
1098016212 12:66107562-66107584 GCAGTAAAGGGTCTTGAGGAAGG - Intergenic
1098494015 12:71113761-71113783 GCAATGATCCTTCCTCAGGATGG + Intronic
1104531452 12:129574990-129575012 GCAGTCAACGCTCCTAAGGAAGG + Intronic
1105244029 13:18631633-18631655 GCAATGAAGCTTCCAGAGGAAGG + Intergenic
1110302025 13:73939842-73939864 GCAGTGAAGCTTCCTGTGTATGG - Intronic
1113147403 13:107222781-107222803 GCAGTGAACTCTCCGCAGGAGGG + Intronic
1113404276 13:110023531-110023553 GCAGTCATCAGTCCTGAGGCGGG + Intergenic
1113852819 13:113427711-113427733 GCAGTCACGCTTCCTGAGGACGG + Intronic
1114189085 14:20427593-20427615 GCAGTGAACTCTGCTCAGGAAGG - Intergenic
1117637840 14:57765284-57765306 GCTGTGAACTGTCCTGAAAAAGG + Intronic
1118915207 14:70097018-70097040 GAAATTAAACGTCCTGAGGAAGG + Intronic
1120380961 14:83779246-83779268 ACAGTGAACCGTCATGCTGAAGG + Intergenic
1121692306 14:95886603-95886625 GCAGGGAACCCTCCAGAGGATGG - Intergenic
1122906625 14:104804715-104804737 GCAGTGACTATTCCTGAGGACGG + Intergenic
1123041654 14:105492713-105492735 GCAGTGCGCCCTCCTGAGCAAGG + Exonic
1128297481 15:66536594-66536616 GAAGTGAACTGTCCAGTGGAAGG + Intronic
1129333341 15:74838751-74838773 GCAGGGAAAGGGCCTGAGGAGGG + Intronic
1129737303 15:77973476-77973498 GCAGTGAGCCTGCCAGAGGAAGG + Intergenic
1129848769 15:78780149-78780171 GCAGTGAGCCTGCCAGAGGAAGG - Intronic
1133100123 16:3474391-3474413 GCAGAGAACCACCCTGGGGAGGG + Intronic
1141412840 16:83847101-83847123 GAAGTAAAGTGTCCTGAGGAAGG - Intergenic
1141579354 16:84986618-84986640 GCAATGAACCCTGCTGTGGAAGG - Intronic
1143738736 17:8935658-8935680 GAAGGCAACCATCCTGAGGAAGG + Intronic
1144093670 17:11880899-11880921 GCAGTGAAGTGTCTGGAGGAAGG - Intronic
1144453841 17:15403129-15403151 GCAGTGAGCAGTGCTGAGAAAGG - Intergenic
1156390881 18:36649453-36649475 GCAGTGAACTATCATTAGGAAGG - Intronic
1160572845 18:79830670-79830692 GCAGGGAACCCTCCTGACAAAGG - Intergenic
1160572851 18:79830701-79830723 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572857 18:79830732-79830754 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572864 18:79830763-79830785 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572871 18:79830794-79830816 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572875 18:79830825-79830847 GCAGAGAACGCTCCTGACGAAGG - Intergenic
1160572880 18:79830856-79830878 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572886 18:79830887-79830909 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572893 18:79830918-79830940 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572900 18:79830949-79830971 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572907 18:79830980-79831002 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572914 18:79831011-79831033 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572921 18:79831042-79831064 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572928 18:79831073-79831095 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572935 18:79831104-79831126 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572942 18:79831135-79831157 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572949 18:79831166-79831188 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572956 18:79831197-79831219 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572963 18:79831228-79831250 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572970 18:79831259-79831281 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572977 18:79831290-79831312 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572984 18:79831321-79831343 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572991 18:79831352-79831374 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160572998 18:79831383-79831405 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160573005 18:79831414-79831436 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160573012 18:79831445-79831467 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160573019 18:79831476-79831498 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160573026 18:79831507-79831529 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160573050 18:79831662-79831684 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160573057 18:79831693-79831715 GCAGGGAACCCTCCTGACGAAGG - Intergenic
1160573064 18:79831724-79831746 GCAGGGAACCCTCCTGATGAAGG - Intergenic
1160810216 19:1010052-1010074 GCAGTGAACCGTCCTGAGGATGG - Exonic
1161628031 19:5338372-5338394 GAAGTGCACCGTCATGATGAGGG + Intronic
1165352720 19:35284892-35284914 GCAGGGAACCGGCCTTAGCATGG - Intronic
1165768930 19:38367327-38367349 GCAGTGAACTGTGCAGGGGAAGG - Intronic
1166684044 19:44784556-44784578 GCAGTCAAAGGTCTTGAGGAAGG + Intronic
1168274618 19:55270505-55270527 GCAGTGGCCCCTGCTGAGGAGGG - Intronic
925530595 2:4856627-4856649 GCTGTGAACAGTCCTGTGCAAGG + Intergenic
928303609 2:30147599-30147621 GGCGTGAACCGTCCTGAGCAGGG + Intronic
930214335 2:48678858-48678880 GAAGTGAACAGTCCTAAAGAGGG - Intronic
931969761 2:67573154-67573176 TCAGTGAATCGATCTGAGGATGG - Intergenic
934049185 2:88196116-88196138 GCAGAGACCTGTCCTGGGGACGG + Intergenic
934611559 2:95741298-95741320 GCAGAGAACAGTCATGGGGAGGG - Intergenic
936509169 2:113131698-113131720 GAAGAGAAAGGTCCTGAGGATGG - Intronic
938288574 2:130137647-130137669 GTGGTGCACCGACCTGAGGAAGG - Intergenic
938427014 2:131201244-131201266 GCGGTGCACTGACCTGAGGAAGG + Intronic
938467958 2:131535287-131535309 GTGGTGCACCGACCTGAGGAAGG + Intergenic
947715995 2:232339086-232339108 GCAGTGGCCCAGCCTGAGGAAGG + Intronic
947735017 2:232449828-232449850 GCAGTGACCTGGCCTGGGGAAGG + Intergenic
1176171448 20:63698137-63698159 GCAGTGAGCCGTGCTGGAGAGGG - Intronic
1178375666 21:32065583-32065605 GCACTGATCCATCATGAGGAAGG - Intergenic
1180012548 21:45060319-45060341 GCAGAGAGCCCTCCTGAGCATGG - Intergenic
952971811 3:38655883-38655905 GCAGTCAAGTGTCTTGAGGAAGG - Intergenic
955392843 3:58533837-58533859 GCAGTCAAGGGTCCTGAGGAAGG - Intronic
955907316 3:63820763-63820785 GCAGTAAAATGTCCTGAGGAGGG - Intronic
973909317 4:55563557-55563579 TCAGTGAACCTTCCTTTGGAGGG - Intronic
978760415 4:112351270-112351292 GCAGTGAACTGGACAGAGGAGGG + Intronic
978885568 4:113762355-113762377 GCAGTGAACCCTGCTGAGGCTGG - Intergenic
980214269 4:129831622-129831644 GCATGGAACCATCTTGAGGAAGG - Intergenic
983619678 4:169747666-169747688 GCAGTGAACTTTCATGGGGAAGG - Intronic
986050482 5:4085325-4085347 GCAGAGAACATTCCTGAGTAAGG - Intergenic
998079618 5:139263720-139263742 GTAGTGAACAGTGCTGTGGAAGG + Intronic
1000027679 5:157374290-157374312 GAGGTGAAATGTCCTGAGGAAGG - Intronic
1002193739 5:177491606-177491628 GCAGGGCACCGCCCTGGGGAGGG - Intronic
1004803104 6:19172799-19172821 GCAGTGAATAGCTCTGAGGATGG - Intergenic
1007226481 6:40318921-40318943 GCAATGAAATGTCCTGAGGAAGG - Intergenic
1008380965 6:50839538-50839560 GCAGTGAAAAGTCCTGAAGTAGG + Intronic
1012631857 6:101480251-101480273 GCAGTAAACTTTCCTGATGATGG + Intronic
1019370377 7:660113-660135 GGAGGGAACTGTCCTGGGGAGGG - Intronic
1024503703 7:50142070-50142092 GCTGTGCTTCGTCCTGAGGAAGG + Intronic
1030947718 7:115746083-115746105 GTAGGGAACCATCCTGGGGATGG - Intergenic
1031407770 7:121406582-121406604 GCAGGGAACCGTCCAAAGGCAGG + Intergenic
1032699300 7:134364720-134364742 GCAGCTAACCTTCCAGAGGATGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035461705 7:159043164-159043186 GCAGTGCAGCTTCCTGAGGTGGG + Exonic
1037453841 8:19044014-19044036 GCAGAGCACAGTCCTGAGGCTGG - Intronic
1045179431 8:99764243-99764265 GCAGTGATCAGTTCTGAGGATGG + Intronic
1050263837 9:3869721-3869743 GCAGTGATAGGTCCTAAGGAAGG - Intronic
1055535942 9:77244497-77244519 GCTGTGAAACCACCTGAGGAGGG + Intronic
1055793118 9:79945141-79945163 GCAGTAAAGTGTCATGAGGAAGG - Intergenic
1061361247 9:130143707-130143729 GGAGAGAACAGTACTGAGGAGGG + Intergenic