ID: 1160811342

View in Genome Browser
Species Human (GRCh38)
Location 19:1014254-1014276
Sequence CGTGGAACCAGGCAGCAACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160811342_1160811350 1 Left 1160811342 19:1014254-1014276 CCAGGTTGCTGCCTGGTTCCACG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1160811350 19:1014278-1014300 CCAGGCCCGGGAAGCTCCCGCGG 0: 1
1: 0
2: 1
3: 18
4: 216
1160811342_1160811356 25 Left 1160811342 19:1014254-1014276 CCAGGTTGCTGCCTGGTTCCACG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1160811356 19:1014302-1014324 CGCCGCTGTCACAGAACTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160811342 Original CRISPR CGTGGAACCAGGCAGCAACC TGG (reversed) Exonic