ID: 1160812873

View in Genome Browser
Species Human (GRCh38)
Location 19:1020543-1020565
Sequence CCCGCCCGGGGACGTCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160812873_1160812882 3 Left 1160812873 19:1020543-1020565 CCGGGTGGACGTCCCCGGGCGGG No data
Right 1160812882 19:1020569-1020591 GGGTCACGAGACGGTGTCCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75
1160812873_1160812889 30 Left 1160812873 19:1020543-1020565 CCGGGTGGACGTCCCCGGGCGGG No data
Right 1160812889 19:1020596-1020618 TCCCAGGGTCAGAGGTCGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 110
1160812873_1160812884 15 Left 1160812873 19:1020543-1020565 CCGGGTGGACGTCCCCGGGCGGG No data
Right 1160812884 19:1020581-1020603 GGTGTCCCTGGCCAATCCCAGGG 0: 1
1: 1
2: 1
3: 13
4: 193
1160812873_1160812883 14 Left 1160812873 19:1020543-1020565 CCGGGTGGACGTCCCCGGGCGGG No data
Right 1160812883 19:1020580-1020602 CGGTGTCCCTGGCCAATCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 137
1160812873_1160812881 -6 Left 1160812873 19:1020543-1020565 CCGGGTGGACGTCCCCGGGCGGG No data
Right 1160812881 19:1020560-1020582 GGCGGGATGGGGTCACGAGACGG 0: 1
1: 0
2: 0
3: 11
4: 152
1160812873_1160812887 22 Left 1160812873 19:1020543-1020565 CCGGGTGGACGTCCCCGGGCGGG No data
Right 1160812887 19:1020588-1020610 CTGGCCAATCCCAGGGTCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160812873 Original CRISPR CCCGCCCGGGGACGTCCACC CGG (reversed) Intronic